View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3606_low_21 (Length: 275)
Name: NF3606_low_21
Description: NF3606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3606_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 40712013 - 40712258
Alignment:
| Q |
19 |
catttttgtgttgaatttgttattaatcggttagaaattgtgttttatgttattgcattttgtttatacctgcatgcccccaaattcagtgtaaaagggt |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40712013 |
catttttgtgttgaatt-gttattaatcggttagaaattgtgttttatgttattgcattttgtttatacctgcatgcccccaaattcagtgtaaaagggt |
40712111 |
T |
|
| Q |
119 |
tttgggatttattggttttagtttttgtttctgcttaggagcaatttcaattggtatgtgtagtttgtttttgaggttcttgttatgtgggtgttgtcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40712112 |
tttgggatttattggttttagtttttgtttctgcttaggagcaatttcaattggtatgtgtagtttgtttttgaggttcttgttatgtgggtgttgtcat |
40712211 |
T |
|
| Q |
219 |
tgtatttcatttgatgagggattgtgtatgtttggtatgtgcctttg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40712212 |
tgtatttcatttgatgagggattgtgtatgtttggtatgtgcctttg |
40712258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University