View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3606_low_35 (Length: 227)
Name: NF3606_low_35
Description: NF3606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3606_low_35 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 306244 - 306023
Alignment:
| Q |
6 |
atgtactgagaaagatcaacatcttaaactataaaacatacaaaattaatggactaatcaagtgatgatcattgatcactgtcaaatgaatacaatataa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
306244 |
atgtactgagaaagatcaacatcttaaactataaaacatacaaaattaatagactaatctagtgatgatcattgatcactgtcaaatgaatacaatataa |
306145 |
T |
 |
| Q |
106 |
tgagaaagattaacatgttaaactatacaaacttaacagattaattaatttcaaaacaatgattaattaccctaatctagtcatgatcactgttaaattg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
306144 |
tgagaaagattaacatgttaaactatacaaacttaacagattaattaatttcaaaacaatgattaattaccctaatctagtcatgatcactgttaaattg |
306045 |
T |
 |
| Q |
206 |
atacatacaatgcactgaatca |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
306044 |
atacatacaatgcactgaatca |
306023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University