View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3607_high_13 (Length: 252)
Name: NF3607_high_13
Description: NF3607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3607_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 39167347 - 39167104
Alignment:
| Q |
1 |
tatggcctccatcaattgtttatgtatctggtttatttgagtacagaaggacagcgtgaggaatcaaagagagcatttgattctgcttcttgctaactcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39167347 |
tatggcctccatcaattgtttatgtatctggtttatttgagtacagaaggacagcgtgaggaatcaaagagagcatttgattctgcttcttgctaactcg |
39167248 |
T |
|
| Q |
101 |
catataaggctacaccctaaacccgagccttttaacaaggcatgtatctgtttcatactttctctgtttcaggcaaaataaaagccaaaactgtaatcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39167247 |
catataaggctacaccctaaacccgagccttttaacaaggcatgtatctgtttcatactttctctgtttcaggcaaaataaaagccaaaactgtaatcaa |
39167148 |
T |
|
| Q |
201 |
aagaacactagtcggtaattgaattcacatgttttttctctgct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39167147 |
aagaacactagtcggtaattgaattcacatgttttttctctgct |
39167104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 59 - 140
Target Start/End: Complemental strand, 43964785 - 43964704
Alignment:
| Q |
59 |
aggaatcaaagagagcatttgattctgcttcttgctaactcgcatataaggctacaccctaaacccgagccttttaacaagg |
140 |
Q |
| |
|
|||||||| ||||||||| | ||| |||||||||||||| ||||||||||||||||| |||||||||||| | ||||||| |
|
|
| T |
43964785 |
aggaatcagagagagcatctaattttgcttcttgctaacaaccatataaggctacaccccaaacccgagcctctcaacaagg |
43964704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University