View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3607_high_22 (Length: 215)
Name: NF3607_high_22
Description: NF3607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3607_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 113 - 204
Target Start/End: Complemental strand, 39167757 - 39167666
Alignment:
| Q |
113 |
ctggaggcattttttgtgtttgcagattattgccgctgccagagatgtccaggaaaacctggagatttatgcacattcatataatattcttc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39167757 |
ctggaggcattttttgtgtttgcagattattgccgctgccagagatgtccaggaaaacctggagatttatgcacattcatataatattcttc |
39167666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University