View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3607_high_7 (Length: 318)
Name: NF3607_high_7
Description: NF3607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3607_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 154 - 305
Target Start/End: Complemental strand, 35093175 - 35093026
Alignment:
| Q |
154 |
gtgttcatatctatgca--tatctctattacgttgctgggttagtttcaatgttttatttaattcccagtgtaattaaagaggtgaggttagtatattgg |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35093175 |
gtgttcatatctatgcaaatatctctattacgttgctgggttagtttcaatgtttta----attcccagtgtaattaaagaggtgaggttagtatattgg |
35093080 |
T |
|
| Q |
252 |
agagttgaggagaacaagaggttaatgtaaataatgaatttgagatattgaagt |
305 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35093079 |
agagttgaggagaacaagagcttaatgtaaataatgaatttgagatattgaagt |
35093026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 35093334 - 35093243
Alignment:
| Q |
1 |
ttcaaaaattaagaaagatttgtattcatgggaaggaagaaatg----------aaatcaaatatgatcatgaatgaggggttggcaacaaa |
82 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35093334 |
ttcaaaaattaagaaagaattgtattcatgggaaggaagaaatgaaatgaaatgaaatgaaatatgatcatgaatgaggggttggcaacaaa |
35093243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University