View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3607_low_12 (Length: 276)
Name: NF3607_low_12
Description: NF3607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3607_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 262
Target Start/End: Complemental strand, 44997533 - 44997282
Alignment:
| Q |
7 |
cctttggctcatatccttgatcgcacaattgaggagtattttttccataagggtgcatcagttggctactaccatggggtatattcaattattcatggag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44997533 |
cctttggctcatatccttgatcgcacaattgaggagtattttttccataagggtgcatctgttggctactaccatggggtatattcaattattcatgcag |
44997434 |
T |
 |
| Q |
107 |
aaatattttcattcatttgaattttcttgacaaagaaaatttccatcaatatattttgtttacttttacatcttatgaatttttggagttgcttgtgaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44997433 |
aaatattttcattcatttgaattttcttgacaaagaaaatttccatca----attttgtttacttttacatcttatgaatttttggagttgcttgtgaat |
44997338 |
T |
 |
| Q |
207 |
gaaggatctaactgcattgagggatgatttaatggaactgaaaccaacactgtttg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44997337 |
gaaggatctaactgcattgagggatgatttaatggaactgaaaccaacactgtttg |
44997282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University