View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3607_low_18 (Length: 244)
Name: NF3607_low_18
Description: NF3607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3607_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 74 - 195
Target Start/End: Original strand, 53493310 - 53493431
Alignment:
| Q |
74 |
gagcagagagagtatatcgtcaaagatatagagaacaaaatataaaatattttctaggggagaacaataaatattgtattgcttagtttcctgaagctat |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53493310 |
gagcagagagagtatatcgtcaaagatatagagaacaaaatataaaatattttctaggggagaacaataaatattgtattgcttagtttcctgaagctat |
53493409 |
T |
|
| Q |
174 |
agtacgcgagacactaaataaa |
195 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53493410 |
agtacgcgagacactaaataaa |
53493431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 133 - 195
Target Start/End: Original strand, 16072530 - 16072592
Alignment:
| Q |
133 |
gagaacaataaatattgtattgcttagtttcctgaagctatagtacgcgagacactaaataaa |
195 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16072530 |
gagaacaataaataatgtattgcttagtttcctgaagctatagtacatgagacactaaataaa |
16072592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University