View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3607_low_21 (Length: 239)
Name: NF3607_low_21
Description: NF3607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3607_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 24041772 - 24041618
Alignment:
| Q |
1 |
tattgagagctacgagaaaccctaatttctttgaaattaagagatctcgaaattgaaatgcgtattggatttaaaaatttgaggttctaccgaaaaagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24041772 |
tattgagagctacgagaaaccctaatttctttgaaattaagagatctcgaaattgaaatgcgtgttggatttaaaaatttgaggttctaccgaaaaagga |
24041673 |
T |
 |
| Q |
101 |
acaacgatgttggaaattttgaaattgatccaatttcgagatttgtgttgattta |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24041672 |
acaacgatgttggaaattttgaaattgatccaatttcgagatttgtgttgattta |
24041618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 222
Target Start/End: Complemental strand, 24041618 - 24041581
Alignment:
| Q |
185 |
acaatcaattggaatacgaatttttgggaggaaagaat |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24041618 |
acaatcaattggaatacgaaattttgggaggaaagaat |
24041581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University