View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3607_low_21 (Length: 239)

Name: NF3607_low_21
Description: NF3607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3607_low_21
NF3607_low_21
[»] chr1 (2 HSPs)
chr1 (1-155)||(24041618-24041772)
chr1 (185-222)||(24041581-24041618)


Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 24041772 - 24041618
Alignment:
1 tattgagagctacgagaaaccctaatttctttgaaattaagagatctcgaaattgaaatgcgtattggatttaaaaatttgaggttctaccgaaaaagga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
24041772 tattgagagctacgagaaaccctaatttctttgaaattaagagatctcgaaattgaaatgcgtgttggatttaaaaatttgaggttctaccgaaaaagga 24041673  T
101 acaacgatgttggaaattttgaaattgatccaatttcgagatttgtgttgattta 155  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24041672 acaacgatgttggaaattttgaaattgatccaatttcgagatttgtgttgattta 24041618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 185 - 222
Target Start/End: Complemental strand, 24041618 - 24041581
Alignment:
185 acaatcaattggaatacgaatttttgggaggaaagaat 222  Q
    |||||||||||||||||||| |||||||||||||||||    
24041618 acaatcaattggaatacgaaattttgggaggaaagaat 24041581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University