View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3607_low_23 (Length: 227)
Name: NF3607_low_23
Description: NF3607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3607_low_23 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 2947545 - 2947319
Alignment:
| Q |
1 |
atgacatttacatttcaggttagttnnnnnnntttcttcatttttaatgtggcacattgtgtgttaatttatcttatttgaaattcaatgaatgatgatt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2947545 |
atgacatttacatttcaggttagttaaaaaaatttcttcatttttaatgtggcacattgtgtgttaatttatcttatttgaaattcaatgaatgatgatt |
2947446 |
T |
|
| Q |
101 |
tgcacagctcataactgaaactgcaagacttgcaaatatagttccaggaatcttccggaaggcactaagggaaattaattttaagggtatgtgattgcta |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2947445 |
tgcacagctcataaccgaaactgcaagacttgcaaatatagttccaggaatcttccggaaggcactaagggaaattaattttaagggtatgtgattgcta |
2947346 |
T |
|
| Q |
201 |
atttaataatacaacattttcaaattt |
227 |
Q |
| |
|
|||||||||||||| |||||||||||| |
|
|
| T |
2947345 |
atttaataatacaaaattttcaaattt |
2947319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University