View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3607_low_25 (Length: 215)

Name: NF3607_low_25
Description: NF3607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3607_low_25
NF3607_low_25
[»] chr8 (1 HSPs)
chr8 (113-204)||(39167666-39167757)


Alignment Details
Target: chr8 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 113 - 204
Target Start/End: Complemental strand, 39167757 - 39167666
Alignment:
113 ctggaggcattttttgtgtttgcagattattgccgctgccagagatgtccaggaaaacctggagatttatgcacattcatataatattcttc 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39167757 ctggaggcattttttgtgtttgcagattattgccgctgccagagatgtccaggaaaacctggagatttatgcacattcatataatattcttc 39167666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University