View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3608_high_20 (Length: 238)
Name: NF3608_high_20
Description: NF3608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3608_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 83 - 237
Target Start/End: Complemental strand, 39678326 - 39678172
Alignment:
| Q |
83 |
tttataatattgtttcgatcatattagaatatcttatttaattttctaggatctgtgtaagtattgtggatattctcttaggattagttttactttactt |
182 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678326 |
tttataatattatttcgatcatattagaatatcttatttaattttctaggatctgtgtaagtattgtggatattctcttaggattagttttactttactt |
39678227 |
T |
 |
| Q |
183 |
acatattattttgatttgtttcttaatttccctatctaggactaagtagtgtatc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678226 |
acatattattttgatttgtttcttaatttccctatctaggactaagtagtgtatc |
39678172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University