View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3608_low_10 (Length: 305)
Name: NF3608_low_10
Description: NF3608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3608_low_10 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 231 - 305
Target Start/End: Original strand, 1481503 - 1481577
Alignment:
| Q |
231 |
ccatgcaggatgaccttttcgagaaacttgcagttcttgaacaattgaaaaagcaaaatgtcgttgacgtagtaa |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1481503 |
ccatgcaggatgaccttttcgagaaacttgcagttcttgaacaattgaaaaagcaaaatgtcgttgacgtagtaa |
1481577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 185
Target Start/End: Original strand, 1601176 - 1601208
Alignment:
| Q |
153 |
tgaaaaggataaagatctcaatgttggtctctc |
185 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
1601176 |
tgaaaaggataaagacctcaatgttggtctctc |
1601208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 21833694 - 21833658
Alignment:
| Q |
149 |
tacctgaaaaggataaagatctcaatgttggtctctc |
185 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
21833694 |
taccagaaaaggataaagaactcaatgttggtctctc |
21833658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 239 - 302
Target Start/End: Complemental strand, 5766910 - 5766847
Alignment:
| Q |
239 |
gatgaccttttcgagaaacttgcagttcttgaacaattgaaaaagcaaaatgtcgttgacgtag |
302 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| ||| |||||||| || |||||| |||| |
|
|
| T |
5766910 |
gatgacctcttggagaaacttgcagttcttgaacaagtgagaaagcaaagtgccgttgaggtag |
5766847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 251 - 302
Target Start/End: Original strand, 14003906 - 14003957
Alignment:
| Q |
251 |
gagaaacttgcagttcttgaacaattgaaaaagcaaaatgtcgttgacgtag |
302 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| || |||||| |||| |
|
|
| T |
14003906 |
gagaaacttgcagttcttgaacaagtgagaaagcaaagtgccgttgaggtag |
14003957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University