View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3608_low_16 (Length: 251)
Name: NF3608_low_16
Description: NF3608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3608_low_16 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 251
Target Start/End: Complemental strand, 51740362 - 51740120
Alignment:
| Q |
9 |
gagatgaagaacaagcgttacaaatactataaaccccaacatcactgacattactgcatttattgatgtccaaaaacttgatccgttggcaaccacttgc |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51740362 |
gagaagaagaacaagcgttacaaatactagaaaccccaacatcactgacagtactgcatttattgatgtccaaaaacttgatccgttggcaaccacttgc |
51740263 |
T |
 |
| Q |
109 |
aaggctcatcagcccattgtcagtgatacttgtgcatccttgcaataccaactcttctaaattacgacagtttttggacagagcttctagtatactattc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
51740262 |
aaggctcatcagcccattgtcagtgatacttgtgcatccttgcaataccaactcttctaaattacgacagtttttggacagagcttctagtatactatcc |
51740163 |
T |
 |
| Q |
209 |
gtaacaaatctgcacccagtaagatgcaatatccacaggtcgc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51740162 |
gtaacaaatctgcacccagtaagatgcaatatccgcaggtcgc |
51740120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University