View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3608_low_22 (Length: 231)
Name: NF3608_low_22
Description: NF3608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3608_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 61 - 218
Target Start/End: Complemental strand, 51527066 - 51526915
Alignment:
| Q |
61 |
tttaaaacggcagtgctatatgtagtgaatcatcatttctctcgctagattcagcattattcattttaaaattcacacacacgcatatgcatatacagaa |
160 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51527066 |
tttaaaacggcagtgctatatgtagcgaatcatcatttctcttgctagattcagcattattcattttaaaattcacacacacgc------atatacagaa |
51526973 |
T |
 |
| Q |
161 |
gtatgttgaagatcatgctcaaatttttgccaagtacttagaataaacttgaatgtga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51526972 |
gtatgttgaagatcatgctcaaatttttgccaagtacttagaataaacttgaatgtga |
51526915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University