View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3608_low_23 (Length: 219)
Name: NF3608_low_23
Description: NF3608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3608_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 31055838 - 31056048
Alignment:
| Q |
1 |
aagttacagctattcttgttctctatggtcttccgaggtaattaatatttaatacacaacaatggaaacttctctttttgtctctctccaattacggatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31055838 |
aagttacagctattcttgttctctatggtcttccgaggtaattaatatttaatacacaacaatggaaacttctctttttgtctctctccaattacagatg |
31055937 |
T |
|
| Q |
101 |
atccactttg-nnnnnnnttagtacctatgaattttgagaaatgatattaagtttcgataacaatttagatggttaacgctgttcaaaccatccactcaa |
199 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31055938 |
atccactttgaaaaaaaattagtatctatgaattttgagaaatgatgttaagtttcgataacaatttagatggttaacgctgttcaaaccatccactcaa |
31056037 |
T |
|
| Q |
200 |
cgcaattaacc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
31056038 |
ggcaattaacc |
31056048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University