View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3611_high_17 (Length: 237)
Name: NF3611_high_17
Description: NF3611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3611_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 34326847 - 34326726
Alignment:
| Q |
1 |
tgcaggtaataattcaacacaaatctgtccaagtctaactactttcttttttggctgaaaattgatgtcagattcaaacgaataataacagcaaaaggag |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34326847 |
tgcatgtaataattcaacacaaatctgtccaagtctaactactttcttttttggctgaaaattgatgtcagattcaaacgaataataacagcaaaaggag |
34326748 |
T |
 |
| Q |
101 |
atgacactgaacttaaaatgaa |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34326747 |
atgacactgaacttaaaatgaa |
34326726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 34326720 - 34326655
Alignment:
| Q |
156 |
attgccatccaatgagaatagcaataaataaaaattgttatatttccatcttttatcctaaggata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34326720 |
attgccatccaatgagaatagcaataaataaaaattgttatatttccatcttttatcctaaggata |
34326655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University