View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3611_high_7 (Length: 324)
Name: NF3611_high_7
Description: NF3611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3611_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 36544773 - 36545080
Alignment:
| Q |
1 |
atttgactcagaatttccctgccacccaataaattttgagctgaaaatgtactctttagttttgatcttctgttacttcttacaggacattcttttaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36544773 |
atttgactcagaatttccctgccacccaataaattttgagctgaaaatgtactctttagttttgatcttctgttacttcttacaggacattcttttaaat |
36544872 |
T |
 |
| Q |
101 |
cattcaactctttcaaattgtctcttttagtgtttgactttgacctcaacaacggcttctttagcttgttggtcccaccaaccaaatttgttacagtaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36544873 |
cattcaactctttcaaattgtctcttttagtgtttgactttgacctcaacaacggcttctttagcttgttggtcccaccaaccaaatttgttacagtaaa |
36544972 |
T |
 |
| Q |
201 |
gtttggatttgtattctcattgtcttcatccatgtttcttgaacaattgggtcttttaggcttgtcacaatccttaacagctgaaggattttccctaata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36544973 |
gtttggatttgtattctcattgtcttcatccatgtttcttgaacaattgggtcttttaggcttgtcacaatccttaacagctgaaggattttccctaata |
36545072 |
T |
 |
| Q |
301 |
gatataca |
308 |
Q |
| |
|
||||||| |
|
|
| T |
36545073 |
catataca |
36545080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University