View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3611_low_12 (Length: 278)
Name: NF3611_low_12
Description: NF3611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3611_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 6 - 269
Target Start/End: Original strand, 16846108 - 16846371
Alignment:
| Q |
6 |
gacatcatcaccaacaccctccgtcctttaaccctacaaaccgacgcttggtgttcctccggtgcagtctctcccaccggaaccctaatccaaaccggtg |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16846108 |
gacatcaccaccaacaccctccgtcctttaaccctacaaaccgacgcttggtgttcctccggtgcagtctcccccaccggaaccctaatccaaaccggtg |
16846207 |
T |
 |
| Q |
106 |
gcttcaacgatggttacaccaaactcagaacgtttacgccttgtcctcataacaacacgtgtgattgggaagagcttcaacagaatctttcttcgagtcg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16846208 |
gcttcaacgatggttacaccaaactcagaacgtttaccccttgtcctcataacaacacgtgtgattgggaagagcttcaacagaatctttcttcgagtcg |
16846307 |
T |
 |
| Q |
206 |
ttggtatgcttcgaatcagattctaccaaacggtagaatcattatcgttggtggtcgttcatct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16846308 |
ttggtatgcttcgaatcagattctaccaaacggtagaatcattgtcgttggtggtcgttcatct |
16846371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 54 - 118
Target Start/End: Original strand, 52913255 - 52913319
Alignment:
| Q |
54 |
tggtgttcctccggtgcagtctctcccaccggaaccctaatccaaaccggtggcttcaacgatgg |
118 |
Q |
| |
|
||||||||||||||| | ||| ||||| |||||| || |||||||||||||| ||||||||||| |
|
|
| T |
52913255 |
tggtgttcctccggttccgtcaatcccaacggaactcttatccaaaccggtggtttcaacgatgg |
52913319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University