View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3612_high_10 (Length: 259)
Name: NF3612_high_10
Description: NF3612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3612_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 242
Target Start/End: Original strand, 36110709 - 36110940
Alignment:
| Q |
11 |
cagagatatgggctacactacattgagatgagacaaattatgtagaaacaacaagtgacattgacttaggaagaggatgaatgaacgaggaaatcgctgg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36110709 |
cagagatatgggctacactacattgagatgagacaaattatgtagaaacaacaagtgacattgacttaggaagaggatgaatgaacgagaaaatcgctgg |
36110808 |
T |
 |
| Q |
111 |
caccgcgtggctatttgtgtgcaaaaccatgtcaatatatgttttttgtgtggcttttatgtgtggaagaacatgcatccaaccacgtggaatgtcgtgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36110809 |
caccgcgtggctatttgtgtgcaaaaccatgtcaatatatgttttttgtgtggcttttatgtgtggaagaacatgcatccaaccacgtggaatgtcgtgt |
36110908 |
T |
 |
| Q |
211 |
gttacgtgcacaagacaaccgtggggctttgt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36110909 |
gttacgtgcacaagacaaccgtggggctttgt |
36110940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University