View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3612_high_12 (Length: 258)
Name: NF3612_high_12
Description: NF3612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3612_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 242
Target Start/End: Original strand, 41066415 - 41066645
Alignment:
| Q |
12 |
atgaatggaaacaaggagatagtgagaaacaagataagaaaatttaatgcattgtttgacatgatgagttggttttctgctactgttctatctcatctaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066415 |
atgaatggaaacaaggagatagtgagaaacaagataagaaaatttaatgcattgtttgacatgatgagttggttttctgctactgttctatctcatctaa |
41066514 |
T |
|
| Q |
112 |
aacatagcagcagtactattttttctgtgttactactctctatttttctctgtatcatttgatacttgttggatattaaaattctcgtatcttcacttaa |
211 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066515 |
aacatagcagcagtactagtttttctatgttactactctctatttttctctttatcatttgatacttgttggatattaaaattctcgtatcttcacttaa |
41066614 |
T |
|
| Q |
212 |
agttactgataaagatgtagacagttctttt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41066615 |
agttactgataaagatgtagacagttctttt |
41066645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University