View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3612_low_19 (Length: 202)
Name: NF3612_low_19
Description: NF3612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3612_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 43537208 - 43537021
Alignment:
| Q |
1 |
tggtagtgggagtcttacaagaaaatcaaggagggcatcccccggtggaagaaatacacacataaggaaggcgaggagtgtccagacttctttgaaggtt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537208 |
tggtagtgggagtcttactagaaaatcaaggagggcatcccccggtggaagaaatacacacataaggaaggcgaggagtgtccagacttctttgaaggtt |
43537109 |
T |
|
| Q |
101 |
gatttggatcatgaggttaatagtggtgctgctcttagtagagcttcaagtttgggactctcattttcctttactggattctctgctcctc |
191 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43537108 |
gatttgg---atgaggttaatagtggtgctgctcttagtagagcttcaagtttgggactctcattttcctttactggattctctgttcctc |
43537021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University