View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3613_high_13 (Length: 281)
Name: NF3613_high_13
Description: NF3613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3613_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 35 - 263
Target Start/End: Original strand, 35850060 - 35850286
Alignment:
| Q |
35 |
attatattttagtaattacagaagagagtaggtctaattnnnnnnnnntgtactgtgtgttcaaaatgaaagtattacaagggcataggggtaactttat |
134 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35850060 |
attatatattagtaattacagaagagagtaggtctaattaaaaaaa--tgtactgtgtgttcaaaatgaaagtattacaagggcataggggtaactttat |
35850157 |
T |
 |
| Q |
135 |
tttagccgattttgtttattttgacatttattcatatttactttgcagtactaagtccaacacacagatcaacccatgaattaggttccatttctcacca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35850158 |
tttagccgattttgtttattttgacatttattcatatttactttgcagtactaagtccaacacacagatcaacccatgaattaggttccatttctcacca |
35850257 |
T |
 |
| Q |
235 |
tgtagcccatcaatccatgatacctcatc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35850258 |
tgtagcccatcaatccatgatacctcatc |
35850286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University