View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3613_high_16 (Length: 266)
Name: NF3613_high_16
Description: NF3613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3613_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 99 - 247
Target Start/End: Complemental strand, 49139656 - 49139502
Alignment:
| Q |
99 |
atttatttattatggaggatgatgccgatgccgctgc------cgctgccgcgaataacaacaatagggtttcttcgtcaaatccttactggctggatgc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49139656 |
atttatttattatggaggatgatgccgatgccgctgctgccgccgctgccgtgaataacaacaatagggtttcttcgtcaaatccttactggctggatgc |
49139557 |
T |
 |
| Q |
193 |
ctgtgaagatatttctatatcttgtgatgatttcattgattttgatgtttctaat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49139556 |
ctgtgaagatatttctatatcttgtgatgatatcattgattttgatgtttctaat |
49139502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 49139751 - 49139691
Alignment:
| Q |
1 |
aatcggaatgaattgatttgaatagaatagaataggcgttgatacacagcaatagggtttg |
61 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49139751 |
aatcggaatgaattgaattgaatagaatagaataggcgttgatacacagcaatagggtttg |
49139691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University