View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3613_high_24 (Length: 240)
Name: NF3613_high_24
Description: NF3613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3613_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 43630029 - 43630235
Alignment:
| Q |
15 |
caaaggcctccaccatgaaggaacacaatcacgggaagtttgttgttcttattgttgttgggtttgtagagacgaagagagagattgaattttttgtcga |
114 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43630029 |
caaaagcctccaccatgaaggaacataatcacgggaagttttttattcttattgttgttgggtttgtagagacgaatagagagattgaattttttgtcga |
43630128 |
T |
|
| Q |
115 |
aaagacagtctttgaaggttacggagttatcttctattgtgggaatttgaaatttgaagtcgttggaacggtaaatggaaccgtcgctatagagttgaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43630129 |
aaagacagtctttgaaggttacggagttatcttctattgttggaatttgaaatttgaagtcgtttgaacggtaaatggaaccgtcgctatagagttgaag |
43630228 |
T |
|
| Q |
215 |
gaagccc |
221 |
Q |
| |
|
||||||| |
|
|
| T |
43630229 |
gaagccc |
43630235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University