View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3613_high_28 (Length: 235)
Name: NF3613_high_28
Description: NF3613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3613_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 41056261 - 41056155
Alignment:
| Q |
1 |
ttacatttttagtcatttacctattattttgcactatttacatgtggattttaagtttcatatttaacatttatatgcaaatatagatgaaagtttgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41056261 |
ttacatttttagtcatttacctattattttgcactatttacatgtggattttaagtttcatatttaacatttatatgcaaatatagatgaaagtttgaga |
41056162 |
T |
|
| Q |
101 |
gaccata |
107 |
Q |
| |
|
||||||| |
|
|
| T |
41056161 |
gaccata |
41056155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University