View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3613_high_29 (Length: 235)
Name: NF3613_high_29
Description: NF3613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3613_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 137 - 221
Target Start/End: Complemental strand, 33116929 - 33116845
Alignment:
| Q |
137 |
aattttattccacctcacattgagagtaaatcacgccaccaaattgagtttgaacttcctgaaatcgcaccttctatgcatagca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116929 |
aattttattccacctcacattgagagtaaatcacgccaccaaattgagtttgaacttcctgaaatcgcaccttctatgcatagca |
33116845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 33117111 - 33117064
Alignment:
| Q |
1 |
gtggtgtagtcttgaagctctggtcttccattaagcttcagtttgtgt |
48 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33117111 |
gtggtgtagtcttgaagctttggtcttcaattaagcttcagtttgtgt |
33117064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University