View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3613_high_31 (Length: 232)
Name: NF3613_high_31
Description: NF3613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3613_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 35010197 - 35010027
Alignment:
| Q |
1 |
caaaacagcaaaattgggattggaagacgaggatggagtatttctttttc---caggaaagggaaagaaagatcttcgcatttcgtaa-gtggtgtatgg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35010197 |
caaaacagcaaaattgggattggaagacggggatggagtatttttttttttttcaggaaagggaaagaaagatctccgcatttcgtaaagtggtgtatgg |
35010098 |
T |
 |
| Q |
97 |
ccttagaaactggatatgcctattttaattcaacttaaatatccaatttacccttttaattatcatattaa |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35010097 |
ccttagaaactggatatgcctattttaattcaacagaaatatccaatttacccttttaattataatattaa |
35010027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 35009024 - 35008985
Alignment:
| Q |
165 |
taataaggtttacccactacaataggtaaaacacagtcct |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35009024 |
taataaggtttacccactgcaataggtaaaacacagtcct |
35008985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University