View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3613_low_14 (Length: 279)
Name: NF3613_low_14
Description: NF3613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3613_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 20 - 267
Target Start/End: Original strand, 44654286 - 44654533
Alignment:
| Q |
20 |
tttagttcgtcaggttaaattgtttgggatcaatcgttttcactagatgtaactaatctctttttatataaaaatatgacattgctttaaactcctagag |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44654286 |
tttagtttgtcaggttaaattgtttgggatcaatcgttttcactagatgtaactaatctctttttatataaaaacatgacattgctttaaactcctagag |
44654385 |
T |
 |
| Q |
120 |
tttgttctagtaataaaaatatatgttttggactcggaggtttttggttcaagatctattaatacttttaaaatgagatagatgtatatatttactatta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44654386 |
tttgttctagtaataaaaatatatgttttggactcggagatttttggttcaagatctattaatacttttaaaacgagatagatgtatatatttactatta |
44654485 |
T |
 |
| Q |
220 |
ttcgagctctaatgtcttctgcttttgactaagcatcccctcaaccta |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44654486 |
ttcgagctctaatgtcttctgcttttgactaagcatcccctcaaccta |
44654533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University