View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3613_low_23 (Length: 240)

Name: NF3613_low_23
Description: NF3613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3613_low_23
NF3613_low_23
[»] chr3 (2 HSPs)
chr3 (1-87)||(41056588-41056674)
chr3 (146-222)||(41056732-41056808)
[»] chr1 (1 HSPs)
chr1 (25-63)||(31667447-31667485)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 41056588 - 41056674
Alignment:
Q  1 ttcaggttgttgacatgagtcgagaatgacacaattaaatgtaatcgcatgtgtcggtgtcggtgctccgagtctttgccttactgc 87  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
T  41056588 ttcaggttgttgacatgagtcgagaatgacacaattaaatgtaatcgcatgtgtcggtgtcggtgctcttagtctttgccttactgc 41056674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 146 - 222
Target Start/End: Original strand, 41056732 - 41056808
Alignment:
Q  146 ggatggattgaaattgatatagctttcagagcctctgactggaaaggtctggacattggaagattttgaggctcatc 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41056732 ggatggattgaaattgatatagctttcagagcctctgactggaaaggtctggacattggaagattttgaggctcatc 41056808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 31667447 - 31667485
Alignment:
Q  25 aatgacacaattaaatgtaatcgcatgtgtcggtgtcgg 63  Q
    ||||||| |||||||||||||| ||||||||||||||||    
T  31667447 aatgacataattaaatgtaatcacatgtgtcggtgtcgg 31667485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University