View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3613_low_29 (Length: 235)

Name: NF3613_low_29
Description: NF3613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3613_low_29
NF3613_low_29
[»] chr1 (2 HSPs)
chr1 (137-221)||(33116845-33116929)
chr1 (1-48)||(33117064-33117111)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 137 - 221
Target Start/End: Complemental strand, 33116929 - 33116845
Alignment:
137 aattttattccacctcacattgagagtaaatcacgccaccaaattgagtttgaacttcctgaaatcgcaccttctatgcatagca 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33116929 aattttattccacctcacattgagagtaaatcacgccaccaaattgagtttgaacttcctgaaatcgcaccttctatgcatagca 33116845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 33117111 - 33117064
Alignment:
1 gtggtgtagtcttgaagctctggtcttccattaagcttcagtttgtgt 48  Q
    ||||||||||||||||||| |||||||| |||||||||||||||||||    
33117111 gtggtgtagtcttgaagctttggtcttcaattaagcttcagtttgtgt 33117064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University