View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3613_low_31 (Length: 232)

Name: NF3613_low_31
Description: NF3613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3613_low_31
NF3613_low_31
[»] chr8 (2 HSPs)
chr8 (1-167)||(35010027-35010197)
chr8 (165-204)||(35008985-35009024)


Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 35010197 - 35010027
Alignment:
1 caaaacagcaaaattgggattggaagacgaggatggagtatttctttttc---caggaaagggaaagaaagatcttcgcatttcgtaa-gtggtgtatgg 96  Q
    ||||||||||||||||||||||||||||| ||||||||||||| |||||    |||||||||||||||||||||| |||||||||||| |||||||||||    
35010197 caaaacagcaaaattgggattggaagacggggatggagtatttttttttttttcaggaaagggaaagaaagatctccgcatttcgtaaagtggtgtatgg 35010098  T
97 ccttagaaactggatatgcctattttaattcaacttaaatatccaatttacccttttaattatcatattaa 167  Q
    ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||| |||||||    
35010097 ccttagaaactggatatgcctattttaattcaacagaaatatccaatttacccttttaattataatattaa 35010027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 35009024 - 35008985
Alignment:
165 taataaggtttacccactacaataggtaaaacacagtcct 204  Q
    |||||||||||||||||| |||||||||||||||||||||    
35009024 taataaggtttacccactgcaataggtaaaacacagtcct 35008985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University