View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3614_high_14 (Length: 394)
Name: NF3614_high_14
Description: NF3614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3614_high_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 19 - 386
Target Start/End: Complemental strand, 35212647 - 35212280
Alignment:
| Q |
19 |
agggaggagttacgaggcgaggatgatgatttcaacaaaaataatggggttgtacagtctgttaagtatttgatttttggaagagaaaatggtgataatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212647 |
agggaggagttacgaggcgaggatgatgatttcaacgaaaataatggggttgtacagtctgttaagtatttgatttttggaagagaaaatggtgataatg |
35212548 |
T |
|
| Q |
119 |
atgatgatatgctttatgaagaccgtgtttttaactatgcttcttcaaattcggtatgtgcattgtgtgctagtgtttgcttaatacattctctaattag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212547 |
atgatgatatgctttatgaagaccgtgtttttaactatgcttcttcaaattcggtatgtgcattgtgtgctagtgtttgcttaatacattctctaattag |
35212448 |
T |
|
| Q |
219 |
tagtaagtcaattttatataccgaaattgtttgtttttacaggctaaatttttgggagtgttgattattataccttgggcaatggattttttggttcatg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35212447 |
tagtaagtcaattttatataccgaaattgtttgtttttacaggctaaatttttgggagtgttgattgttataccttgggcaatggattttttggttcatg |
35212348 |
T |
|
| Q |
319 |
actatttactcatgccttttttagacaggtaacctactttcttactcagatcttatatttttcttctc |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35212347 |
actatttactcatgccttttttagacaggtaacctactttcttactcagatcttatatttttcttctc |
35212280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University