View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3614_high_18 (Length: 318)
Name: NF3614_high_18
Description: NF3614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3614_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 1156682 - 1156900
Alignment:
| Q |
1 |
tgcagcctctactctcctataacataacaacataaaatagctaaaacctcacaaaatagtgagttgaattggaggaagggaaggtctgtgtagaatagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1156682 |
tgcagcctctactctcctataacataacaacataaaatagctaaaacctcacaaaagagtgagttgaattggaggaagggaaggtctgtgtagaatagtg |
1156781 |
T |
 |
| Q |
101 |
agctgattttttcatatatctgaaggtggataagggaatggatgattgggaaatgaagtgtggatgcccatcgatgaatttcttgtattatttttaatta |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1156782 |
agctgaatttttcatatatctgaaggtggagaagggaatagatgattgggaaatgaagtgtggatgcccatcgatgaatttcttgtattatttttaatta |
1156881 |
T |
 |
| Q |
201 |
aacattgatgaatttcttg |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1156882 |
aacattgatgaatttcttg |
1156900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 286 - 318
Target Start/End: Original strand, 1156967 - 1156999
Alignment:
| Q |
286 |
taaccaacacttctctcttctctatttcttctc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1156967 |
taaccaacacttctctcttctctatttcttctc |
1156999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University