View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3614_high_21 (Length: 274)
Name: NF3614_high_21
Description: NF3614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3614_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 20 - 149
Target Start/End: Complemental strand, 11413060 - 11412928
Alignment:
| Q |
20 |
gtcatttttccaggctcaagctctgtcttgtaatataatataatcaagggtcgttccacagca-taattaattagaactcttattagtaagctaaaataa |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||| || |||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11413060 |
gtcatttttccaggctcaagctttgtctcgtggtataatataatcaagggtcgttccactgcactaattaattagaactcttattactaagctaaaataa |
11412961 |
T |
 |
| Q |
119 |
tgtgttttca--taaacaattggataatgatac |
149 |
Q |
| |
|
| ||||||| |||||||||| ||||||||| |
|
|
| T |
11412960 |
cgcgttttcactcaaacaattgggtaatgatac |
11412928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 173 - 257
Target Start/End: Complemental strand, 10568304 - 10568220
Alignment:
| Q |
173 |
atttgtcaataacacccttaattattacagagtggcatttgtagagtacttaccaataggtgtttaaccgatttaacaccaaact |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
10568304 |
atttgtcaataacacccttaattattacagagtgacatttgtagagtacttatcaataggtgtttaaccgatttaacagcaaact |
10568220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University