View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3614_high_22 (Length: 262)
Name: NF3614_high_22
Description: NF3614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3614_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 16 - 248
Target Start/End: Original strand, 3064954 - 3065186
Alignment:
| Q |
16 |
ccaccacaacaatcgtagcagacaccgtcccaacaactccagcaacgacaaaataaggcctccgacgatatcccaatatcggaaaagcatcggttagaat |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3064954 |
ccaccgcaacaatcgtagcagacaccgtcccaacaactccagcaacgacaaaataaggcctccgacgatatcccaatatcggaaaagcatcggttagaat |
3065053 |
T |
 |
| Q |
116 |
tccccagataggttttagaatccatggtatgaagtatattcctacgtagagttgaactgttgaaggttggagtttttgaacgtctttccaatagtaatca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3065054 |
tccccagataggttttagaatccatggtatgaagtatattcctacgtagagttgaactgttgaaggttggagtttttgaacgtctttccaatagtaatca |
3065153 |
T |
 |
| Q |
216 |
gtgactagtttgaagagtgagcctgtgaaacct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3065154 |
gtgactagtttgaagagtgagcctgtgaaacct |
3065186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University