View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3614_high_26 (Length: 250)
Name: NF3614_high_26
Description: NF3614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3614_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 46304456 - 46304695
Alignment:
| Q |
1 |
taggttacctttcttttataatgtacattatacattataacttggatatttctaatatttcagttgtggtatgttttgcacaatgatacagtggattgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46304456 |
taggttacctttcttttataatgtacattatacattataacttggatatttctaatatttcagttgtggtatgttttgcacaatgatacagtggattgcg |
46304555 |
T |
 |
| Q |
101 |
agggaatatgttgactggaattttgtctccggatatttgccaattatctggtttgtggtacttgtgagtaatcaagccctgtcatatttaannnnnnnna |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46304556 |
agggaatatgttgactggaattttgtctccggatatttgccaattatctggtttgtggtacttgtgagtaatcaagccctgtcatatttaatttttttta |
46304655 |
T |
 |
| Q |
201 |
tatgtactaagtttattctagacttctgttttgacctttg |
240 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
46304656 |
tatgtactaagtttattctggacttctgttttgacttttg |
46304695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 92 - 163
Target Start/End: Original strand, 26377138 - 26377209
Alignment:
| Q |
92 |
tggattgcgagggaatatgttgactggaattttgtctccggatatttgccaattatctggtttgtggtactt |
163 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
26377138 |
tggattgcgagggaacatgttgattggatttttgtctcctgatatttgccaattatctagtttgtggtactt |
26377209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University