View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3614_low_19 (Length: 308)
Name: NF3614_low_19
Description: NF3614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3614_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 305
Target Start/End: Original strand, 39092512 - 39092798
Alignment:
| Q |
18 |
attttctgataattacttgagttaagattgttgttgtcaattggtgcttgaactgttgttgtggatatcactttcatggaatccatgaacaacttttggt |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39092512 |
attttatgataattacttgagttaagattgttgttgtcaattggtgcttgaactgttgttgtggatatcactttcatggaatccatgaacaacttttggt |
39092611 |
T |
 |
| Q |
118 |
actctttcttttgggtagtttgatgatcagactcagggggattaactatcttatattctctctcttattgggtcaagattgctcgaatattatttactag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39092612 |
actctttcttttgggtagtttgatgatcagactcagggggattaactatcttatattctctctctt-ttgggtcaagattgctcgaatattatttactag |
39092710 |
T |
 |
| Q |
218 |
agtactacactcatgcatctcatgtatcagaaataatatcttatgttgtttcaattacaaaactataatagcaatacaacttctttgt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||| |
|
|
| T |
39092711 |
agtactacactcatgcatctcatgtatcagaaataatatcttatgttgtttcaattaaaaaactataaaagcaaaacaacttctttgt |
39092798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 33 - 109
Target Start/End: Original strand, 39089121 - 39089197
Alignment:
| Q |
33 |
cttgagttaagattgttgttgtcaattggtgcttgaactgttgttgtggatatcactttcatggaatccatgaacaa |
109 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
39089121 |
cttgagttgagattattgtggtcaattggtgcttgaactgttgttgtggatatcactttgatggaagccatgaacaa |
39089197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 22 - 106
Target Start/End: Original strand, 39083458 - 39083542
Alignment:
| Q |
22 |
tctgataattacttgagttaagattgttgttgtcaattggtgcttgaactgttgttgtggatatcactttcatggaatccatgaa |
106 |
Q |
| |
|
||||||||| | ||||||| ||||| |||||||||||||||||||||||| |||||||||||||||| | |||||||||||||| |
|
|
| T |
39083458 |
tctgataatcagttgagttgagattattgttgtcaattggtgcttgaacttttgttgtggatatcacactaatggaatccatgaa |
39083542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University