View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3615_high_12 (Length: 323)
Name: NF3615_high_12
Description: NF3615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3615_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 19 - 315
Target Start/End: Original strand, 4133365 - 4133661
Alignment:
| Q |
19 |
attatggcatatttcttggtgactccttgatagattggaaattgaagaagcaagctattgttgctcgctctttagcagaggctgaatacattgccatttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4133365 |
attatggcatatttcttggtgactccttgatagattggaaattgaagaagcaagctattgttgctcgctctttagcagaggctgaatacattgccatttc |
4133464 |
T |
 |
| Q |
119 |
tgccttcacatctgagttattgtggcggcatagacaattattcagagcttttgatgttattgttgatttaagtatggttaccaaaaatcgagttattttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
4133465 |
tgccttcacatctgagttattgtggcggcatagacaattattcagagcttttgttgttattgttgatttaagtatggttactaaaaattgagttattttt |
4133564 |
T |
 |
| Q |
219 |
tatacagggccatttctaattttattaccaaataaaataaagatgagggaatgaggagcaagtaatgtagctacctacctggatggtaacttcatct |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4133565 |
tatacagggccatttctaattttattaccaaataaaataaagatgagggaatgaggagcaagtaatgtagctacctacctggatggtaacttcatct |
4133661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 46 - 186
Target Start/End: Complemental strand, 41080556 - 41080419
Alignment:
| Q |
46 |
tgatagattggaaattgaagaagcaagctattgttgctcgctctttagcagaggctgaatacattgccatttctgccttcacatctgagttattgtggcg |
145 |
Q |
| |
|
|||||| |||||||| |||||||||||| || ||||| ||| | |||||||||||||||| |||||| ||||| |||||||||||||||||| | |
|
|
| T |
41080556 |
tgatagcttggaaatccaagaagcaagctcctgatgctctctcctccgcagaggctgaatacagggccattgctgccctcacatctgagttattgt---g |
41080460 |
T |
 |
| Q |
146 |
gcatagacaattattcagagcttttgatgttattgttgatt |
186 |
Q |
| |
|
|||||||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
41080459 |
acatagacaattactcacagctttagatgttattgttgatt |
41080419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 44 - 144
Target Start/End: Complemental strand, 41091908 - 41091808
Alignment:
| Q |
44 |
cttgatagattggaaattgaagaagcaagctattgttgctcgctctttagcagaggctgaatacattgccatttctgccttcacatctgagttattgtgg |
143 |
Q |
| |
|
|||||||| ||||||| ||||||| || |||||||||||||||||| |||||||||||||| | |||||| ||||| |||||||||||||| ||||| |
|
|
| T |
41091908 |
cttgatagcttggaaaccgaagaagtaaactattgttgctcgctcttctgcagaggctgaatagagggccattgctgccctcacatctgagttactgtgg |
41091809 |
T |
 |
| Q |
144 |
c |
144 |
Q |
| |
|
| |
|
|
| T |
41091808 |
c |
41091808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University