View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3615_high_17 (Length: 262)
Name: NF3615_high_17
Description: NF3615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3615_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 38833306 - 38833516
Alignment:
| Q |
18 |
ggagcaatgtgggacttgactcttatctctatgtccctataagtctgcatttcatgtgctagctagatctacttttgggatcacgagatttctatttatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38833306 |
ggagcaatgtgggacttgactcttatctctatgtccctataagtctgcatttcatgtgctagctagatctacttttgggatcacgagatttctatttatt |
38833405 |
T |
 |
| Q |
118 |
ttatctgtctactcttctcaaagctaatgaactgggacacacatcatgtgccaccgtgaaaagctgagactaattaacaattcaattttgcatattgcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
38833406 |
ttatctgtctactcttctcaaagctaatgaactgcgacacacatcatgtgccaccgtgaaaagctgagactaataaacaattcaattttgcataaagcca |
38833505 |
T |
 |
| Q |
218 |
caaaacaaata |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
38833506 |
caaaacaaata |
38833516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University