View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3615_low_10 (Length: 358)
Name: NF3615_low_10
Description: NF3615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3615_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 6 - 345
Target Start/End: Complemental strand, 17091284 - 17090945
Alignment:
| Q |
6 |
tcttcggttttgcctttgccttcggaacaccttcaaatggtttcattggaaaacatttctttggtctgaaagatgttccgacagaaaattttgattacag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
17091284 |
tcttcggttttgcctttgccttcggaacaccttcaaatggtttcataggaaaacatttcttcggtctgaaggatgttccgacagcaaattttgattacag |
17091185 |
T |
 |
| Q |
106 |
ctattttctctatcaatgggcttttgctatagcagccgctggtatcaccagcggctctatagcggaacgaactcagttcgttgcttatcttatatactca |
205 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17091184 |
ttattttctttatcaatgggcttttgctatagcagccgctggtatcaccagcggctctatagcggaacgaactcagttcgttgcttatcttatatactca |
17091085 |
T |
 |
| Q |
206 |
tcttttctcacagggtttgtataccctgtggtttctcattggttctggtccggtgatggttgggctagcgcaaccaacaccggcaacctactctttggta |
305 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17091084 |
tcttttctcacagggtttgtttaccctgtggtttctcattggttctggtccggtgatggttgggctagcgcaaccaacaccggcaacctactctttggta |
17090985 |
T |
 |
| Q |
306 |
ccggagtcattgatttcgctggctccggtgttgttcatat |
345 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17090984 |
caggagtcattgattttgctggctccggtgttgttcatat |
17090945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 8 - 72
Target Start/End: Complemental strand, 39642005 - 39641941
Alignment:
| Q |
8 |
ttcggttttgcctttgccttcggaacaccttcaaatggtttcattggaaaacatttctttggtct |
72 |
Q |
| |
|
||||| ||||||||||| ||||| |||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
39642005 |
ttcgggtttgcctttgctttcggcacaccttctaatggtttcattggaaaacattttttcggtct |
39641941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 11 - 72
Target Start/End: Complemental strand, 46670199 - 46670138
Alignment:
| Q |
11 |
ggttttgcctttgccttcggaacaccttcaaatggtttcattggaaaacatttctttggtct |
72 |
Q |
| |
|
||||||||| | || || |||||||||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
46670199 |
ggttttgccctagcttttggaacaccttcaaacggtttcataggaaaacatttttttggtct |
46670138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University