View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3615_low_2 (Length: 492)
Name: NF3615_low_2
Description: NF3615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3615_low_2 |
 |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (2 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
| [»] scaffold0106 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 7e-78; HSPs: 205)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 7e-78
Query Start/End: Original strand, 245 - 396
Target Start/End: Original strand, 43368362 - 43368513
Alignment:
| Q |
245 |
ggtcaccaaaacttcaaactctaggattcggaagtttggtggtgttctattattgttatcatttgggaaagtcttactaacaagtgcacgatatatgtta |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43368362 |
ggtcaccaaaacttcaaactctaggattcggaagtttggtggtgttctattattgttatcatttgggaaagtcttactaacaagtgcacgatatatgtta |
43368461 |
T |
 |
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43368462 |
aaagactaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
43368513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 29 - 181
Target Start/End: Original strand, 43368144 - 43368298
Alignment:
| Q |
29 |
gtgtcagacacaatatatatccgacaccgacatacgtctaatctaacaaatatatgt--gctttattggttatatctaagaatatcgacatttacaagtt |
126 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43368144 |
gtgtcagacacaatatgtaaccgacaccgacatacgtctaatctaacaaatatatatatgctttattggttatatctaagaatatcgacatttacaagtt |
43368243 |
T |
 |
| Q |
127 |
aaaccagacctaatcgactaggagaatccttttggtacttagagtctctattggc |
181 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43368244 |
aaacctgacctaatcgactaggagaatccttttggtacttagagtctctattggc |
43368298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 428 - 484
Target Start/End: Original strand, 43368977 - 43369033
Alignment:
| Q |
428 |
caccattgtgaagaccgaagactacttttatttttgttttattctttagcctatgct |
484 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43368977 |
caccattgtgaagaccgaagactacttttatttttgttttattctttagcctatgct |
43369033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 346 - 404
Target Start/End: Complemental strand, 22099914 - 22099856
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
22099914 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgt |
22099856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 342 - 396
Target Start/End: Complemental strand, 29380916 - 29380862
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29380916 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29380862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 24474965 - 24474915
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24474965 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
24474915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 34361801 - 34361851
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34361801 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
34361851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 41921086 - 41921036
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41921086 |
aaggctaaaatatggttttagcccctgcaaatatgtttcgttttggtttta |
41921036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 404
Target Start/End: Complemental strand, 45474598 - 45474540
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
45474598 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctctgt |
45474540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 55072387 - 55072437
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
55072387 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
55072437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 9289265 - 9289314
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9289265 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
9289314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 13479612 - 13479563
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13479612 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 22584286 - 22584343
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
22584286 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctgt |
22584343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 46088061 - 46088012
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46088061 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
46088012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 46115784 - 46115731
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
46115784 |
taaaaggctaaaatatggttttagtccctgcaaatacgtctcgttttggtttta |
46115731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 46128918 - 46128865
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
46128918 |
taaaaggctaaaatatggttttagtccctgcaaatacgtctcgttttggtttta |
46128865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 13064469 - 13064417
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13064469 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
13064417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 19321859 - 19321811
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
19321811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 25424316 - 25424264
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
25424316 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25424264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 28809184 - 28809132
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28809184 |
aaaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
28809132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 50714565 - 50714517
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
50714517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 51708692 - 51708748
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
51708692 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctg |
51708748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 14791809 - 14791758
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
14791809 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
14791758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 16712694 - 16712643
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16712694 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16712643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 344 - 395
Target Start/End: Original strand, 29380664 - 29380715
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29380664 |
aaaaggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt |
29380715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 30564830 - 30564881
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30564830 |
aaagactaaaatatggttttagtccctgcaaatatgttttgttttggtttta |
30564881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 43231085 - 43231136
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
43231085 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
43231136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 45505897 - 45505846
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45505897 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
45505846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 404
Target Start/End: Complemental strand, 46292654 - 46292595
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
46292654 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgt |
46292595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 13764809 - 13764759
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
13764809 |
aaggctaaaatatggttttggtccctgtaaatatgtttcgttttggtttta |
13764759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 18205154 - 18205204
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18205154 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18205204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 18205521 - 18205475
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
18205475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 23778962 - 23779012
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23778962 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
23779012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 25423922 - 25423972
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
25423922 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25423972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 395
Target Start/End: Complemental strand, 29463916 - 29463866
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29463916 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
29463866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 32208540 - 32208590
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32208540 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32208590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 32365485 - 32365435
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32365485 |
aaggctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
32365435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 36701998 - 36702048
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
36701998 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
36702048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 41345851 - 41345901
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41345851 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
41345901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 404
Target Start/End: Original strand, 51545627 - 51545685
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
51545627 |
aaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctctgt |
51545685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 52017503 - 52017553
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52017503 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
52017553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 52017872 - 52017822
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52017872 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
52017822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 52442094 - 52442044
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
52442094 |
aaggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
52442044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 404
Target Start/End: Complemental strand, 54208827 - 54208769
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
54208827 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
54208769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 8760786 - 8760733
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
8760786 |
taaaaggctaaaatatggttttagtccttgcaaatatggctcgttttggtttta |
8760733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 9289640 - 9289591
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9289640 |
aggcttaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
9289591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 13631227 - 13631276
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
13631227 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13631276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 29420538 - 29420489
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
29420538 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
29420489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 32365093 - 32365142
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32365093 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32365142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 35119287 - 35119340
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
35119287 |
taaaaggctaaaatatggttttggtccctgcaaatatgctccgttttggtttta |
35119340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 35464017 - 35464066
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35464017 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35464066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 35763646 - 35763695
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35763646 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35763695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 41346219 - 41346170
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
41346219 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
41346170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 344 - 401
Target Start/End: Original strand, 44925481 - 44925538
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctc |
401 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||| |
|
|
| T |
44925481 |
aaaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtctc |
44925538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 45593587 - 45593538
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
45593587 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggtttta |
45593538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 47023106 - 47023057
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47023106 |
aggctaaaatatggttttgatccctgcaaatatgtttcgttttggtttta |
47023057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 51709029 - 51708972
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||| |||||| |
|
|
| T |
51709029 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctg |
51708972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 52430101 - 52430052
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
52430101 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagtttta |
52430052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 52441762 - 52441811
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
52441762 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
52441811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 53716920 - 53716969
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
53716920 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
53716969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 53916048 - 53915999
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
53916048 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
53915999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 351 - 404
Target Start/End: Complemental strand, 55072709 - 55072656
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
55072656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 2034859 - 2034807
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
2034859 |
aaaaggctaaaatatggttttagtcccagcaaatatgcctcgttttggtttta |
2034807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 2322436 - 2322384
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
2322436 |
aaaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
2322384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 5827977 - 5827925
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5827977 |
aaaaggctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
5827925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 404
Target Start/End: Original strand, 7639892 - 7639952
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||| |||||||||||||||| |||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
7639892 |
aaaaagctaaaatatggttttggtccctacaaatatgtcttgttttggttttaatctctgt |
7639952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 395
Target Start/End: Complemental strand, 12152494 - 12152446
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
12152494 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
12152446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 13073759 - 13073807
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13073807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 22099543 - 22099591
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22099591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 24774041 - 24774093
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24774041 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24774093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 28809011 - 28809059
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggtttta |
28809059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 31560327 - 31560379
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31560327 |
aaaaggctaaaatatggttttgatccctgcaaatatgcttcgttttggtttta |
31560379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 35415633 - 35415585
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35415585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 38054542 - 38054594
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38054542 |
aaaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
38054594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 53717174 - 53717126
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
53717126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 5052587 - 5052536
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5052587 |
aaaggctacaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5052536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 13530716 - 13530665
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
13530716 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
13530665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 15555637 - 15555590
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
15555590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 29499179 - 29499230
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29499179 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29499230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 30046795 - 30046744
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30046795 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
30046744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 30061136 - 30061085
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30061136 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
30061085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 42848024 - 42848075
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
42848024 |
aaaggctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
42848075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 43231392 - 43231341
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
43231392 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
43231341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 2180218 - 2180268
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
2180218 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
2180268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 6827544 - 6827594
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
6827544 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
6827594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 6827876 - 6827826
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
6827876 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
6827826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 8760602 - 8760652
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
8760602 |
aaggctaaaatatagttttactccctgcaaatatgtctcgttttggtttta |
8760652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 13631601 - 13631551
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
13631601 |
aaggctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
13631551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 348 - 394
Target Start/End: Original strand, 13764613 - 13764659
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
13764659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 19903653 - 19903607
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19903607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 23779227 - 23779177
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
23779227 |
aaggctaaaatatggttttaatccctgcaaatatgtctcattttggtttta |
23779177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 396
Target Start/End: Complemental strand, 31560701 - 31560647
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
31560701 |
ttaaatggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
31560647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 31811923 - 31811973
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31811923 |
aaggctaaaatatggttttgatccctgcaaatatgtatcgttttggtttta |
31811973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 31812215 - 31812165
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
31812215 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
31812165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 41620258 - 41620208
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
41620258 |
aaggctaaaatatggttttagtccctgtaaatatgcatcgttttggtttta |
41620208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 45505598 - 45505648
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
45505598 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
45505648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 52543420 - 52543470
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
52543420 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 123533 - 123582
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
123533 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
123582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 4279021 - 4279070
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
4279021 |
aggctaaaatatggttttagcccctgcaaatatatctcgttttggtttta |
4279070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 8904881 - 8904934
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
8904881 |
taaaaggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 11693122 - 11693073
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
11693122 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
11693073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 13064158 - 13064207
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
13064158 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
13064207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 14488188 - 14488139
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
14488188 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
14488139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 15555506 - 15555551
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
15555551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 20291985 - 20292042
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
20291985 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtctctgt |
20292042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 22584608 - 22584559
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
22584608 |
aggctaaaatgtggttttagtctctgcaaatatgcttcgttttggtttta |
22584559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 23245596 - 23245547
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
23245596 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
23245547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 26412189 - 26412238
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26412189 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
26412238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 28449216 - 28449163
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||| |||||||| |
|
|
| T |
28449216 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttgattttaatc |
28449163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 345 - 394
Target Start/End: Complemental strand, 31182507 - 31182458
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| |||||||||||| |
|
|
| T |
31182507 |
aaaggctaaaatatggttttaattcctgcaaatatgtctcgttttggttt |
31182458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 35415298 - 35415347
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
35415298 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggtttta |
35415347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 41619902 - 41619947
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
41619947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 42823775 - 42823824
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
42823775 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
42823824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 51545966 - 51545921
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
51545921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 51738136 - 51738185
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
51738136 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
51738185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 395
Target Start/End: Original strand, 4211560 - 4211608
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
4211560 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
4211608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 4279335 - 4279287
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggtttta |
4279287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 5797817 - 5797769
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| ||||||||||||||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatc |
5797769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 5827655 - 5827703
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
5827703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 11285499 - 11285551
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
11285499 |
aaaatgctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
11285551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 395
Target Start/End: Original strand, 14487801 - 14487849
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
14487801 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
14487849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 23245231 - 23245279
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23245279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 26313988 - 26314036
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggtttta |
26314036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 26314336 - 26314284
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
26314336 |
aaaaggctaaaatatggttttgatccctgaaaatatgtctcgttttggtttta |
26314284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 26412584 - 26412536
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
26412536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 27008084 - 27008132
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
27008132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 35464382 - 35464334
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35464334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 42848391 - 42848343
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
42848343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 43368777 - 43368729
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
43368777 |
ggctaaaatatggttttaattccggcaaatatgtttcgttttggtttta |
43368729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 46115414 - 46115462
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
46115462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 46128548 - 46128596
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
46128596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 47274230 - 47274182
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggtttta |
47274182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 50714240 - 50714288
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
50714288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 53308068 - 53308020
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggtttta |
53308020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 395
Target Start/End: Complemental strand, 9446323 - 9446276
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggtttt |
9446276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 28448833 - 28448888
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctct |
402 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| |||||||||||||| ||||| |
|
|
| T |
28448833 |
aggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtctct |
28448888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 347 - 394
Target Start/End: Complemental strand, 35119612 - 35119565
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||| |||||||||||| |
|
|
| T |
35119612 |
aggctaaaatatggttttggtcactgcaaatatgtctcgttttggttt |
35119565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 36050289 - 36050336
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
36050336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 395
Target Start/End: Original strand, 46292392 - 46292439
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
46292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 47136170 - 47136123
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
47136123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 394
Target Start/End: Complemental strand, 8191391 - 8191345
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggttt |
8191345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 9445951 - 9445997
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
9445997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 404
Target Start/End: Original strand, 16712331 - 16712385
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtctctgt |
16712385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 18831176 - 18831130
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggtttta |
18831130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 27427870 - 27427919
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
27427870 |
aaggctaaaatatggttt-agtccctgcaaatatggctcgttttggtttta |
27427919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 398
Target Start/End: Original strand, 29463610 - 29463660
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaat |
398 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| |||||||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggttttaat |
29463660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 29499548 - 29499498
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29499548 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29499498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 32208903 - 32208853
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||| ||||| |
|
|
| T |
32208903 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttgatttta |
32208853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 47022738 - 47022788
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
47022738 |
aaggataaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
47022788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 54903477 - 54903427
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
54903477 |
aaggctaaaatatggttttggtccctgcaaatatgccccgttttggtttta |
54903427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 5882551 - 5882599
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
5882551 |
aggctaaaatatggttttagt-cctgcaaatatgcctcgttttggtttta |
5882599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 12791975 - 12791926
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
12791975 |
aggctaaaatatgatttttgtccctgcaaatatgcctcgttttggtttta |
12791926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 13074126 - 13074077
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
13074126 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggtttta |
13074077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 13530378 - 13530427
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
13530378 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgatttta |
13530427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 14594205 - 14594254
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || |||||||||| |
|
|
| T |
14594205 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggtttta |
14594254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 404
Target Start/End: Original strand, 14791502 - 14791555
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgt |
14791555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 24474599 - 24474647
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagt-cctgcaaatatgcatcgttttggtttta |
24474647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 34355284 - 34355235
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
34355284 |
aggctaaaatatggttttagtccctcaaaatatgactcgttttggtttta |
34355235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35763956 - 35763907
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
35763956 |
aggctaaaatatgattttagtccctgcagatatgcctcgttttggtttta |
35763907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 50822013 - 50822058
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggtttta |
50822058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 53915682 - 53915731
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
53915682 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
53915731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 2180572 - 2180524
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggtttta |
2180524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 7642652 - 7642604
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| || | ||| ||||||||||||||||||||||||||| |
|
|
| T |
7642652 |
ggctaaaatatgattatggtctctgcaaatatgtttcgttttggtttta |
7642604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 25358540 - 25358492
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggtttta |
25358492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 396
Target Start/End: Original strand, 31370796 - 31370852
Alignment:
| Q |
340 |
tgttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
31370796 |
tgttaataggctaaaatatggttttagtgtctgcgaatatgcctcgttttggtttta |
31370852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 42824091 - 42824043
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | |||||| ||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgatttta |
42824043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 51830885 - 51830937
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||| ||||||||||||||| |||||| | |||||||||||| |
|
|
| T |
51830885 |
aaaagtctaaaatatagttttagtccctgcatatatgtcttgttttggtttta |
51830937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 55482468 - 55482420
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggtttta |
55482420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 353 - 396
Target Start/End: Complemental strand, 123893 - 123850
Alignment:
| Q |
353 |
aaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggtttta |
123850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 2322094 - 2322141
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggtttta |
2322141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 6353637 - 6353590
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggtttta |
6353590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 346 - 397
Target Start/End: Complemental strand, 20144733 - 20144682
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaa |
397 |
Q |
| |
|
||||||||||||||||||| || | |||||||||| ||||||||||||||| |
|
|
| T |
20144733 |
aaggctaaaatatggttttggttcatgcaaatatgcctcgttttggttttaa |
20144682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 358 - 393
Target Start/End: Complemental strand, 25358499 - 25358464
Alignment:
| Q |
358 |
tggttttagtccctgcaaatatgtttcgttttggtt |
393 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25358499 |
tggttttagtccctgcaaatatgtctcgttttggtt |
25358464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 353 - 396
Target Start/End: Complemental strand, 27008401 - 27008358
Alignment:
| Q |
353 |
aaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggtttta |
27008358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 36702362 - 36702315
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| |||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggtttta |
36702315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 353 - 396
Target Start/End: Complemental strand, 47532667 - 47532624
Alignment:
| Q |
353 |
aaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggtttta |
47532624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 387
Target Start/End: Original strand, 9836829 - 9836871
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgtt |
387 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
9836829 |
aaaggctaaaatatggttttgatccttgcaaatatgtttcgtt |
9836871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 343 - 381
Target Start/End: Original strand, 12791604 - 12791642
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgt |
381 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
12791604 |
taaaatgctaaaatatagttttagtccctgcaaatatgt |
12791642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 35420393 - 35420439
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| || |||||||||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggtttta |
35420439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 35420701 - 35420655
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||| |||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggtttta |
35420655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 36054152 - 36054102
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
36054152 |
aaggctaaaatacggttttggtccctgcaaatatgcctcattttggtttta |
36054102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 50753920 - 50753970
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| | | |||||||||||| |
|
|
| T |
50753920 |
aaggttaaaatatggttttggtccctgcaaatatatcttgttttggtttta |
50753970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 51762868 - 51762918
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| || ||| ||||||||||| ||| ||||||||||| |
|
|
| T |
51762868 |
aaggctaaaatatggtattggtctctgcaaatatgcttcattttggtttta |
51762918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 5797484 - 5797529
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggtttta |
5797529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 380
Target Start/End: Original strand, 12152153 - 12152186
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
12152153 |
aggctaaaatatggttttggtccctgcaaatatg |
12152186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 379
Target Start/End: Original strand, 17281565 - 17281602
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
17281565 |
ttaaaaggctaaaatgtgcttttagtccctgcaaatat |
17281602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 379
Target Start/End: Original strand, 17370067 - 17370104
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
17370067 |
ttaaaaggctaaaatgtgcttttagtccctgcaaatat |
17370104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 18135793 - 18135837
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
18135793 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggtttta |
18135837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 20144423 - 20144468
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
20144468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 349 - 394
Target Start/End: Original strand, 25358213 - 25358258
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
25358213 |
gctaaaatatgattttaatccatgcaaatatgcttcgttttggttt |
25358258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 30060772 - 30060817
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgttttta |
30060817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 404
Target Start/End: Original strand, 41439790 - 41439843
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||| | ||| |||||| | |||||||||||||| ||||||| |
|
|
| T |
41439790 |
taaaatatggttttagcctctgtaaatatttctcgttttggttttagtctctgt |
41439843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 380
Target Start/End: Original strand, 41920771 - 41920800
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41920771 |
taaaatatggttttagtccctgcaaatatg |
41920800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 45593227 - 45593276
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
45593227 |
aggctaaaatatagttttagtccctacaaatatgcctcgttttggcttta |
45593276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 49123000 - 49123044
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
49123000 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggtttta |
49123044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 344 - 381
Target Start/End: Complemental strand, 50822298 - 50822261
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgt |
381 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
50822298 |
aaaaggctaaaatatggttttactccatgcaaatatgt |
50822261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 18136117 - 18136065
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||||| |||||||||||||| |
|
|
| T |
18136117 |
aaaaggctaaaatatgactttaatccctacaaatatgcctcgttttggtttta |
18136065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 376
Target Start/End: Original strand, 41324765 - 41324797
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaa |
376 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
41324765 |
aaaaggctaaaatatggttttggtccctgcaaa |
41324797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 41324890 - 41324842
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggtttta |
41324842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 379
Target Start/End: Complemental strand, 45619791 - 45619759
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
45619791 |
aggctaaaatatgtttttagtccctgcaaatat |
45619759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 49123325 - 49123273
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||||| |||||||||||||| |
|
|
| T |
49123325 |
aaaaggctaaaatatgactttaatccctacaaatatgcctcgttttggtttta |
49123273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 395
Target Start/End: Complemental strand, 51738412 - 51738364
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||| |||| |
|
|
| T |
51738412 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttgatttt |
51738364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 51763206 - 51763154
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||| ||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
51763206 |
aaaatgctaaaatatagttttggtccctgcaaatatgcctcattttggtttta |
51763154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 379
Target Start/End: Complemental strand, 51831002 - 51830974
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51831002 |
taaaatatggttttagtccctgcaaatat |
51830974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 1e-20; HSPs: 182)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 41693671 - 41693722
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41693671 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
41693722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 348 - 404
Target Start/End: Complemental strand, 10375069 - 10375013
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgt |
10375013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 340 - 404
Target Start/End: Original strand, 31644833 - 31644897
Alignment:
| Q |
340 |
tgttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
31644833 |
tgtttaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
31644897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 344 - 404
Target Start/End: Original strand, 37228729 - 37228789
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
37228729 |
aaaaggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctgt |
37228789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Original strand, 38639411 - 38639467
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
38639411 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctg |
38639467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 340 - 404
Target Start/End: Complemental strand, 44994069 - 44994005
Alignment:
| Q |
340 |
tgttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||| ||||||| |
|
|
| T |
44994069 |
tgttaaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtctctgt |
44994005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 19183779 - 19183830
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19183779 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19183830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 25954112 - 25954163
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25954112 |
aaaggctaaaatatgtttttagtccctgcaaatatgtttcgttttggtttta |
25954163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 404
Target Start/End: Complemental strand, 37911122 - 37911064
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
37911122 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgt |
37911064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 10671942 - 10671893
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10671942 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10671893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 11788417 - 11788368
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11788417 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
11788368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 30215417 - 30215470
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
30215417 |
taaaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
30215470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 146690 - 146642
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
146642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 5790899 - 5790851
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
5790851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 9195054 - 9195102
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
9195102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 11713485 - 11713533
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
11713533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 25705081 - 25705133
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
25705081 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25705133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 26813866 - 26813914
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26813914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 26814233 - 26814181
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26814233 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
26814181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 36622250 - 36622298
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
36622298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 404
Target Start/End: Complemental strand, 41791312 - 41791256
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtctctgt |
41791256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 3838263 - 3838216
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
3838216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 24483894 - 24483843
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24483894 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24483843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 399
Target Start/End: Complemental strand, 33733241 - 33733190
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatc |
33733190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 37271736 - 37271787
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37271736 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37271787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 38980256 - 38980205
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38980256 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
38980205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 4424187 - 4424137
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
4424187 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4424137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 16900208 - 16900158
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16900208 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16900158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 16993599 - 16993549
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16993599 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16993549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 17541778 - 17541728
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
17541778 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
17541728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 19184153 - 19184103
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19184153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19184103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 22881611 - 22881661
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22881611 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22881661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 33576119 - 33576069
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
33576119 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
33576069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 33732860 - 33732910
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33732860 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33732910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 37272104 - 37272054
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37272104 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37272054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 41451831 - 41451885
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
41451831 |
ttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
41451885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 43789194 - 43789144
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
43789194 |
aaggctaaaatatggttttagttcctgcaaatatgcttcgttttggtttta |
43789144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 350 - 404
Target Start/End: Complemental strand, 44559407 - 44559353
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
44559353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 3832634 - 3832589
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
3832589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 13215059 - 13215108
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
13215059 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13215108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 14003408 - 14003457
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
14003408 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
14003457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 20131316 - 20131365
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
20131316 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
20131365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 26238808 - 26238861
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
26238808 |
taaaaggttaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
26238861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 26239161 - 26239112
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
26239161 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
26239112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 345 - 394
Target Start/End: Original strand, 27310873 - 27310922
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27310873 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 29865512 - 29865463
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
29865512 |
aggctaaaatatggttttagtccttgcaaatatgcttcgttttggtttta |
29865463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 40302340 - 40302291
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40302340 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
40302291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 43788857 - 43788906
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43788857 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
43788906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 44559061 - 44559110
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
44559061 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
44559110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 44985985 - 44985936
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
44985985 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
44985936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 8046325 - 8046377
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
8046325 |
aaaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
8046377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 11713849 - 11713797
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11713849 |
aaaaggctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
11713797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 351 - 403
Target Start/End: Original strand, 17912452 - 17912504
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctg |
17912504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 404
Target Start/End: Complemental strand, 18113454 - 18113398
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgt |
18113398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 36622588 - 36622536
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36622588 |
aaaagactaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
36622536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 42695868 - 42695916
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42695916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 10374775 - 10374822
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10374822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 390
Target Start/End: Original strand, 10664983 - 10665026
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttg |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10664983 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttg |
10665026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 16673408 - 16673459
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
16673408 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
16673459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 17541379 - 17541430
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
17541379 |
aaaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttta |
17541430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 20939324 - 20939277
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
20939277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 404
Target Start/End: Original strand, 29182165 - 29182224
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
29182165 |
aaaggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtctctgt |
29182224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 43672321 - 43672270
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |||||||||||| |
|
|
| T |
43672321 |
aaaggctaaaatatgattttggtccctgcaaatatgttttgttttggtttta |
43672270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 398
Target Start/End: Original strand, 45442315 - 45442366
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaat |
398 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgattttaat |
45442366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 2265399 - 2265349
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
2265399 |
aaggctaaaatatgattttagtccttgcaaatatgtctcgttttggtttta |
2265349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 2481559 - 2481509
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
2481559 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2481509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 3837931 - 3837981
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
3837931 |
aaggctaaaatatagttttagtccctgcaaatatgtctcgttttcgtttta |
3837981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 4423893 - 4423943
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
4423893 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
4423943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 14003744 - 14003694
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14003744 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
14003694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 15842825 - 15842775
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
15842825 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
15842775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 16522989 - 16523039
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
16522989 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16523039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 396
Target Start/End: Complemental strand, 16523331 - 16523277
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
16523331 |
ttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16523277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 17302145 - 17302095
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
17302145 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
17302095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 19831506 - 19831556
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19831506 |
aaggttaaaatatggttttagtctttgcaaatatgtttcgttttggtttta |
19831556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 29859874 - 29859824
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29859874 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29859824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 354 - 396
Target Start/End: Original strand, 35155298 - 35155340
Alignment:
| Q |
354 |
aatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggtttta |
35155340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 36815837 - 36815787
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
36815837 |
aaggctaaaatatggttttggtccatgcaaatatgtctcgttttggtttta |
36815787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 38731827 - 38731877
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38731827 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
38731877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 42358697 - 42358747
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42358697 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
42358747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 43597501 - 43597451
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
43597501 |
aaggctaaaatatgattttagtccctgctaatatgtctcgttttggtttta |
43597451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 43671932 - 43671982
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
43671932 |
aaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggtttta |
43671982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 44073809 - 44073759
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
44073809 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
44073759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 44985623 - 44985669
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44985669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 45442698 - 45442648
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
45442698 |
aaggctaaaatatgattttagtccttgcaaatatgtctcgttttggtttta |
45442648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 4042605 - 4042658
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
4042605 |
taaaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
4042658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 9195207 - 9195158
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
9195207 |
aggctaaaatatggttttagaccctgcaaatatgcctcgttttggtttta |
9195158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 10671629 - 10671678
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
10671629 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggtttta |
10671678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 404
Target Start/End: Complemental strand, 13850881 - 13850828
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtctctgt |
13850828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 23989837 - 23989886
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
23989837 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
23989886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 23990193 - 23990148
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
23990148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 24358615 - 24358664
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24358615 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24358664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 25705450 - 25705401
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
25705450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25705401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 26707872 - 26707921
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
26707872 |
aggctaaaatatggttttaatccctgcaaatatacttcgttttggtttta |
26707921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 27311070 - 27311021
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
27311070 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
27311021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 32691312 - 32691369
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
32691312 |
aggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgt |
32691369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 344 - 389
Target Start/End: Complemental strand, 32691639 - 32691594
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgtttt |
389 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
32691639 |
aaaaggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 33575751 - 33575800
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
33575751 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
33575800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 37229039 - 37228994
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggtttta |
37228994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 38979889 - 38979938
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtt-tcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggtttta |
38979938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 343 - 380
Target Start/End: Original strand, 40301970 - 40302007
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40301970 |
taaaaggctaaaatatggttttagtccctgcaaatatg |
40302007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 40786459 - 40786508
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
40786459 |
aggctaaaatatggttttattcactgcaaatatgtctcgttttggtttta |
40786508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 43592045 - 43592094
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
43592045 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
43592094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 43597153 - 43597202
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
43597153 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
43597202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 3671192 - 3671144
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3671144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 4042890 - 4042842
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggtttta |
4042842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 4794130 - 4794178
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
4794178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 5334751 - 5334799
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5334799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 5335040 - 5334992
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5334992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 5790558 - 5790606
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggtttta |
5790606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 8046648 - 8046600
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
8046600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 395
Target Start/End: Complemental strand, 13215366 - 13215318
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
13215366 |
aggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 17912808 - 17912756
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtctctg |
17912756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 20131681 - 20131633
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20131633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 395
Target Start/End: Complemental strand, 20658410 - 20658362
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
20658410 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 31226077 - 31226029
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggtttta |
31226029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 34964159 - 34964111
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagtttta |
34964111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 352 - 396
Target Start/End: Complemental strand, 36806892 - 36806848
Alignment:
| Q |
352 |
aaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
36806848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 41694003 - 41693955
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
41693955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 2481190 - 2481241
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| || | ||||||||||| |||||||||||||| |
|
|
| T |
2481190 |
aaaggctaaaatatggttttggtacttgcaaatatgtctcgttttggtttta |
2481241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 353 - 404
Target Start/End: Complemental strand, 4794468 - 4794417
Alignment:
| Q |
353 |
aaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||| |||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtctctgt |
4794417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 10665297 - 10665246
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
10665297 |
aaaggctaaaatatagttttagtctctgcaaatatgcatcgttttggtttta |
10665246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 29865222 - 29865269
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
29865269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 146328 - 146374
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
146374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 404
Target Start/End: Complemental strand, 1696457 - 1696399
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||| ||||||||| |||| |||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
1696457 |
aaggttaaaatatgattttcgtcccttcaaatatgtctcgttttggtttcaatctctgt |
1696399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 7814244 - 7814294
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
7814244 |
aaggctaaaatattgttttagtccctgtaaatatgcctcgttttggtttta |
7814294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 18113087 - 18113137
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
18113087 |
aaggctaaaatatggttttggtccctgcaaatatgcctagttttggtttta |
18113137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 344 - 394
Target Start/End: Complemental strand, 23732332 - 23732282
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
23732332 |
aaaaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
23732282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 24358947 - 24358897
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
24358947 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
24358897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 25300038 - 25299993
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggtttta |
25299993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 31225713 - 31225763
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
31225713 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
31225763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 350 - 395
Target Start/End: Original strand, 1137983 - 1138028
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
1138028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 1138360 - 1138311
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
1138360 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttagtttta |
1138311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 1295544 - 1295499
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggtttta |
1295499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 3671002 - 3671051
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
3671002 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgatttta |
3671051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 7814738 - 7814689
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
7814738 |
aggctaaaatatgattttagtccctgcaaatatgcctcattttggtttta |
7814689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 15842464 - 15842509
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
15842509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 16673772 - 16673723
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
16673772 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgtttta |
16673723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 20658060 - 20658109
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
20658060 |
aggctaaaacatggttttagtccctgcaaatatgccttgttttggtttta |
20658109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 392
Target Start/End: Original strand, 26709695 - 26709740
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggt |
392 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
26709695 |
aggctaaaatatgattttagttcctgcaaatatgtctcgttttggt |
26709740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 29831812 - 29831865
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||||||| |||| |
|
|
| T |
29831812 |
aaggctaaaatatagttttgatccctgcaaatatgtctcgttttggtttcaatc |
29831865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 29859490 - 29859535
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29859535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 30215872 - 30215823
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
30215872 |
aggctaaaatatggttttggtccctgcaaatatatcgcgttttggtttta |
30215823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 31909479 - 31909423
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
31909479 |
aggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtctctgt |
31909423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 35155624 - 35155571
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| | |||||| ||||| |
|
|
| T |
35155624 |
taaaaggctaaaatatggttttggtccctgaaaatatgtcttgttttgatttta |
35155571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 1497610 - 1497658
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgatttta |
1497658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 3172016 - 3172068
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| || ||||||||||| |
|
|
| T |
3172016 |
aaaaggctaaaatatgattttggtccctgcaaatatgcctcattttggtttta |
3172068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 3172536 - 3172484
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||| |||||||||||||| |
|
|
| T |
3172536 |
aaaaggctaaaatatgattttggtccttgcaaatatgcctcgttttggtttta |
3172484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 12835325 - 12835373
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggtttta |
12835373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 23732039 - 23732087
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggtttta |
23732087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 27109073 - 27109121
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggtttta |
27109121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 376
Target Start/End: Complemental strand, 29311632 - 29311600
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaa |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29311632 |
aaaaggctaaaatatggttttagtccctgcaaa |
29311600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 31325920 - 31325968
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagtttta |
31325968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 31326256 - 31326204
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
31326256 |
aaaaggctaaaatatagttttagtccttgcaaatatgcctcgttttagtttta |
31326204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 34317798 - 34317846
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
34317846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 40124966 - 40125014
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
40125014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 4842865 - 4842912
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggtttta |
4842912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 24483401 - 24483448
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggtttta |
24483448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 404
Target Start/End: Original strand, 34963796 - 34963851
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| |||||| ||||| ||||||| |
|
|
| T |
34963796 |
gctaaaatatggttttgatccctgctaatatgttttgttttgattttagtctctgt |
34963851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 42696202 - 42696155
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
42696155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 1497943 - 1497897
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggtttta |
1497897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 5006605 - 5006655
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||| | |||||||||||||| |
|
|
| T |
5006605 |
aaggttaaaatatggttttggtctctgcaaatatatctcgttttggtttta |
5006655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 14393130 - 14393081
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||| ||| ||||||||||||| |||||||||||||| |
|
|
| T |
14393130 |
aaggctaaaatatgattt-agttcctgcaaatatgtctcgttttggtttta |
14393081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 16968550 - 16968600
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
16968550 |
aaggttaaaatatggttttagtccctacaaatatgccttgttttggtttta |
16968600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 25954428 - 25954378
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
25954428 |
aaggttaaaatatggttttagtccttgcaaatatgcctcgttttgatttta |
25954378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 29182440 - 29182394
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggtttta |
29182394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 32476093 - 32476143
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
32476093 |
aaggctaaaatatggttttgatccctgcaaatatgcctcattttggtttta |
32476143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 41791020 - 41791066
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || ||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggtttta |
41791066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 43592382 - 43592332
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| || ||||| ||||| |
|
|
| T |
43592382 |
aaggctaaaatatgattttagtccctgctaatatgtctcattttgatttta |
43592332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 395
Target Start/End: Original strand, 43672005 - 43672039
Alignment:
| Q |
361 |
ttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
43672005 |
ttttggtccctgcaaatatgtttcgttttggtttt |
43672039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 43710710 - 43710660
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||| || |||||||||| |||||||||||||| |
|
|
| T |
43710710 |
aaggctaaaatatgattttagcccttgcaaatatgcctcgttttggtttta |
43710660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 44993806 - 44993851
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggtttta |
44993851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 3832271 - 3832320
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| ||||||| | || |||||||||| |||||||||||| |
|
|
| T |
3832271 |
aggctaaaatatgattttagttcttgtaaatatgtttggttttggtttta |
3832320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 361 - 398
Target Start/End: Complemental strand, 16900135 - 16900098
Alignment:
| Q |
361 |
ttttagtccctgcaaatatgtttcgttttggttttaat |
398 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggttttaat |
16900098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 361 - 398
Target Start/End: Complemental strand, 16993526 - 16993489
Alignment:
| Q |
361 |
ttttagtccctgcaaatatgtttcgttttggttttaat |
398 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggttttaat |
16993489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 358 - 395
Target Start/End: Complemental strand, 33576076 - 33576039
Alignment:
| Q |
358 |
tggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||| |
|
|
| T |
33576076 |
tggttttagtccctgcaaatatgtctcattttggtttt |
33576039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 35686335 - 35686290
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
35686335 |
taaaatatggttttgatccctgtaaatatgcttcgttttggtttta |
35686290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 404
Target Start/End: Complemental strand, 38732130 - 38732077
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||| || |||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
38732130 |
taaaatttgattttagtcccagcaaatatggctcgttttggttttaatccctgt |
38732077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Complemental strand, 42358872 - 42358843
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42358872 |
aggctaaaatatggttttagtccctgcaaa |
42358843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 43710384 - 43710429
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
43710384 |
taaaatataattttagtcccttcaaatatgtctcgttttggtttta |
43710429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 7121308 - 7121261
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||| |||||| |
|
|
| T |
7121308 |
ggctaaaatatggttttagt-cctgtaaatatgtttcattttagtttta |
7121261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 346 - 398
Target Start/End: Original strand, 13802484 - 13802536
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaat |
398 |
Q |
| |
|
|||||||||||||||||||||| | || |||||| |||||||||||||||| |
|
|
| T |
13802484 |
aaggctaaaatatggttttagttcttgtaaatattcctcgttttggttttaat |
13802536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 34318083 - 34318035
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| |||||||| ||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgatttta |
34318035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 5e-20; HSPs: 169)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 346 - 404
Target Start/End: Original strand, 7272418 - 7272476
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
7272418 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgt |
7272476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 14238746 - 14238799
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14238746 |
taaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
14238799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 18549200 - 18549257
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
18549200 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgt |
18549257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 344 - 403
Target Start/End: Original strand, 1525805 - 1525864
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
1525805 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctctg |
1525864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 16789073 - 16789123
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16789073 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
16789123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 25131109 - 25131159
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25131109 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
25131159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 350 - 399
Target Start/End: Original strand, 10776150 - 10776199
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatc |
10776199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 19494118 - 19494167
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19494118 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19494167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 29158353 - 29158402
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29158353 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29158402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 33636321 - 33636370
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33636321 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
33636370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 7420226 - 7420278
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
7420226 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
7420278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 24187901 - 24187849
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24187901 |
aaaaggctaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
24187849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 29488114 - 29488062
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29488114 |
aaaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
29488062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 32418314 - 32418366
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32418314 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32418366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 40844156 - 40844204
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
40844204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 8298978 - 8298927
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
8298978 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8298927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 22650461 - 22650512
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
22650461 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
22650512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 27341594 - 27341543
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27341594 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
27341543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 32725904 - 32725955
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
32725904 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
32725955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 349 - 404
Target Start/End: Complemental strand, 36044791 - 36044736
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggttttaatctctgt |
36044736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 399
Target Start/End: Original strand, 42132864 - 42132915
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatc |
42132915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 43477160 - 43477211
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43477160 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
43477211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 349 - 399
Target Start/End: Original strand, 4016906 - 4016956
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatc |
4016956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 9496725 - 9496675
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
9496725 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
9496675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 10540784 - 10540734
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
10540784 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
10540734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 11019518 - 11019568
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
11019518 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
11019568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 14239082 - 14239032
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14239082 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14239032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 14495067 - 14495117
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14495067 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14495117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 16644046 - 16643996
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16644046 |
aaggctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
16643996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 404
Target Start/End: Original strand, 21125717 - 21125775
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
21125717 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
21125775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 22917562 - 22917612
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22917562 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22917612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 24187567 - 24187617
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
24187567 |
aaggctaaaatatggttttaatccctgcaaatatgcttcgttttggtttta |
24187617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 25600224 - 25600278
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
25600224 |
ttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25600278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 28323847 - 28323897
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
28323847 |
aaggctaaaatatggttgtagtccctgcaaatatgcttcgttttggtttta |
28323897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 38930300 - 38930350
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
38930300 |
aaggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
38930350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 1526173 - 1526124
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1526173 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
1526124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 3512267 - 3512218
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
3512267 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3512218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 8094478 - 8094527
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
8094478 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggtttta |
8094527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 9496340 - 9496389
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
9496340 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
9496389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 10337118 - 10337167
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
10337118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10337167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 13155252 - 13155195
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13155252 |
aggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgt |
13155195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 19494414 - 19494365
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19494365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 24955011 - 24954962
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24955011 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
24954962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 28399036 - 28398987
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28399036 |
aggctaaaatatgattttagtccctgcaaatatggttcgttttggtttta |
28398987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 32040074 - 32040123
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
32040074 |
aggctaaaatatgatcttagtccctgcaaatatgtttcgttttggtttta |
32040123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 35097327 - 35097376
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35097327 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35097376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 35345618 - 35345561
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35345618 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgt |
35345561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35346999 - 35346950
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35346999 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35346950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 38930666 - 38930613
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38930666 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatc |
38930613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 40492959 - 40493008
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
40492959 |
aggctaaaatatggttttagtacctgcaaatatgtctcgttttggtttta |
40493008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 1162909 - 1162957
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgatttta |
1162957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 1685110 - 1685162
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1685110 |
aaaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1685162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 1778564 - 1778612
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1778612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 4017304 - 4017252
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
4017304 |
aaaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
4017252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 4375692 - 4375740
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4375740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 6146953 - 6146901
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6146953 |
aaaaagctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
6146901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 7186004 - 7185956
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
7185956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 8298587 - 8298635
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8298635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 404
Target Start/End: Original strand, 9832211 - 9832271
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||| ||||||||| |||| ||||||||||||| ||||||||||||||| |||| |
|
|
| T |
9832211 |
aaaaggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgt |
9832271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 10776499 - 10776451
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10776451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 14489073 - 14489025
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
14489025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 15719656 - 15719704
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggtttta |
15719704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 16789369 - 16789321
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16789321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 29487750 - 29487798
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggtttta |
29487798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 346 - 394
Target Start/End: Complemental strand, 30337219 - 30337171
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
30337219 |
aaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 33526052 - 33526100
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggtttta |
33526100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 34963664 - 34963616
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
34963616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 35346629 - 35346677
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35346677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 37536082 - 37536134
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
37536082 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
37536134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 37536419 - 37536371
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
37536371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 42133154 - 42133106
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42133106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 2728229 - 2728280
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
2728229 |
aaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
2728280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 399
Target Start/End: Complemental strand, 10755528 - 10755477
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatc |
10755477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 11976370 - 11976421
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
11976370 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
11976421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 404
Target Start/End: Original strand, 14488713 - 14488772
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
14488713 |
aaaggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgt |
14488772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 20984143 - 20984194
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
20984143 |
aaaggctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
20984194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 20984513 - 20984462
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
20984513 |
aaaggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
20984462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 404
Target Start/End: Complemental strand, 24090487 - 24090432
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgt |
24090432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 40066494 - 40066545
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
40066494 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
40066545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 40844538 - 40844487
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
40844538 |
aaaggttaaaatatggttttagtccctgcaaatatatctcgttttggtttta |
40844487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 14496814 - 14496864
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
14496814 |
aaggctaaaatatggttttagttcctgcaaatatgcgtcgttttggtttta |
14496864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 18549571 - 18549525
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggtttta |
18549525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 28346392 - 28346442
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
28346392 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28346442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 34963298 - 34963348
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
34963298 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
34963348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 388
Target Start/End: Complemental strand, 4376011 - 4375970
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttt |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4376011 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttt |
4375970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 4473703 - 4473752
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
4473703 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
4473752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 4710221 - 4710172
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
4710221 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
4710172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 8094842 - 8094793
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
8094842 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
8094793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 11019858 - 11019809
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
11019858 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
11019809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 11976733 - 11976688
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
11976688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 13232201 - 13232246
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13232246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 16643660 - 16643709
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
16643660 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
16643709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 17073806 - 17073855
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
17073806 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
17073855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 17574464 - 17574415
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
17574464 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
17574415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 28346759 - 28346710
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
28346759 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28346710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 32726272 - 32726223
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
32726272 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
32726223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 33526413 - 33526364
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
33526413 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
33526364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 1408005 - 1408053
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagtttta |
1408053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 2728597 - 2728549
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2728549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 346 - 402
Target Start/End: Complemental strand, 2811783 - 2811727
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctct |
402 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
2811783 |
aaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtctct |
2811727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 7272751 - 7272703
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggtttta |
7272703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 7326421 - 7326373
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
7326373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 20277688 - 20277740
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
20277688 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
20277740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 21064315 - 21064367
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
21064315 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
21064367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 25131447 - 25131399
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
25131399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 25600601 - 25600549
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
25600601 |
aaaaggctaaaatatagttttggtccctgcaaatatgtcttgttttggtttta |
25600549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 29158669 - 29158621
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggtttta |
29158621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 35097692 - 35097644
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35097644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 40066820 - 40066772
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggtttta |
40066772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 42430120 - 42430072
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
42430072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 5357762 - 5357715
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggtttta |
5357715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 6146517 - 6146564
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
6146564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 9175009 - 9175060
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
9175009 |
aaaggctaaaatatgattttggtccttgcaaatatgtctcgttttggtttta |
9175060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 10872912 - 10872963
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
10872912 |
aaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
10872963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 30969399 - 30969446
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggtttta |
30969446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 380
Target Start/End: Complemental strand, 1408355 - 1408321
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1408355 |
aaggctaaaatatggttttagtccctgcaaatatg |
1408321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 4474046 - 4473996
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
4474046 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
4473996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 7420592 - 7420542
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
7420592 |
aaggctaaaatatggttttggtcactgcaaatatgcctcgttttggtttta |
7420542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 13779151 - 13779197
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
13779197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 395
Target Start/End: Complemental strand, 27117979 - 27117929
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || |||||||||| |
|
|
| T |
27117979 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttt |
27117929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 28324183 - 28324133
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||| | |||||||||||| |
|
|
| T |
28324183 |
aaggctaaaatatggttttggtccctacaaatatgtcttgttttggtttta |
28324133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 43727431 - 43727386
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggtttta |
43727386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 3511905 - 3511954
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
3511905 |
aggctaaaatatggttttggtcccttcaaatatgcctcgttttggtttta |
3511954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 5357422 - 5357471
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5357422 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
5357471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 6469279 - 6469328
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
6469279 |
aggctaaaatatggctttcgtccctgcaaatatgcctcgttttggtttta |
6469328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 6469668 - 6469619
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||| ||||||||||||| |
|
|
| T |
6469668 |
aggctaaaatatgattttggtcactgcaaatatgttacgttttggtttta |
6469619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 7326085 - 7326134
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
7326085 |
aggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttta |
7326134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 404
Target Start/End: Complemental strand, 9175368 - 9175315
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtctctgt |
9175315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 10337450 - 10337401
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
10337450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
10337401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 19962994 - 19963043
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
19962994 |
aggctaaaatatggtgttagtccttgcaaatatgtctcgttttagtttta |
19963043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 20278058 - 20278009
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
20278058 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggtttta |
20278009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 21064685 - 21064636
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
21064685 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggtttta |
21064636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 24815069 - 24815020
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||| || ||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggtttta |
24815020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 27117752 - 27117801
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
27117752 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgatttta |
27117801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 28258242 - 28258193
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
28258242 |
aggctaaaatatggttttaacctctgcaaatatgtctcgttttggtttta |
28258193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 348 - 393
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtt |
393 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 345 - 398
Target Start/End: Original strand, 44997928 - 44997981
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaat |
398 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
44997928 |
aaaggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaat |
44997981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 360 - 404
Target Start/End: Complemental strand, 1778917 - 1778873
Alignment:
| Q |
360 |
gttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctgt |
1778873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 4621354 - 4621306
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
4621306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 10873280 - 10873232
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
10873232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 13232562 - 13232514
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
13232514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 14495389 - 14495342
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggtttta |
14495342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 23939547 - 23939595
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||| ||||||| |||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagtttta |
23939595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 380
Target Start/End: Original strand, 28398756 - 28398788
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28398756 |
ggctaaaatatggttttagtccctgcaaatatg |
28398788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 28497251 - 28497303
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
28497251 |
aaaaggctaaaatatgattttggtccctgcaaatatgcctcgttttagtttta |
28497303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 395
Target Start/End: Complemental strand, 35115640 - 35115592
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
35115640 |
aggctaaaatatggttttagtccctacaaatatacctcgttttggtttt |
35115592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 13779531 - 13779484
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggtttta |
13779484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 15719983 - 15719928
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
15719983 |
aaaaggctaaaatataattttagtttctgcaaatatgtcttgttttggttttaatc |
15719928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 404
Target Start/End: Original strand, 29991912 - 29991971
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||| ||||||| |||||| ||||||| |
|
|
| T |
29991912 |
aaaggttaaaatatggttttggtctctgcaaatatgcctcgttttagttttagtctctgt |
29991971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 395
Target Start/End: Original strand, 2355958 - 2355992
Alignment:
| Q |
361 |
ttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
2355958 |
ttttggtccctgcaaatatgtttcgttttggtttt |
2355992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 348 - 390
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttg |
390 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| |||||||| |
|
|
| T |
9908918 |
ggctaaaatatagttttaatccctgcaaatatgtctcgttttg |
9908960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 395
Target Start/End: Original strand, 20277765 - 20277799
Alignment:
| Q |
361 |
ttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
20277765 |
ttttagtccctgcaaatatgcttcgttttggtttt |
20277799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 395
Target Start/End: Original strand, 21064392 - 21064426
Alignment:
| Q |
361 |
ttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
21064392 |
ttttagtccctgcaaatatgcttcgttttggtttt |
21064426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 347 - 381
Target Start/End: Complemental strand, 25702810 - 25702776
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgt |
381 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
25702810 |
aggctaaaatatggttttggtccctgcaaatatgt |
25702776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 380
Target Start/End: Original strand, 43727097 - 43727127
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatg |
43727127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 395
Target Start/End: Complemental strand, 3680803 - 3680754
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||||||||||| |
|
|
| T |
3680803 |
aaggctaaaatatgattttgatccctgcaaatatgcctcgttttggtttt |
3680754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 10540448 - 10540497
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
10540448 |
aggctaaaatattgttttggtctctgcaaatatgcctcgttttggtttta |
10540497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 21126022 - 21125973
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||| || ||||||| |||||||||||||| |
|
|
| T |
21126022 |
aggctaaaatatagttttagtccatgtaaatatgactcgttttggtttta |
21125973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 380
Target Start/End: Complemental strand, 21509919 - 21509886
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
21509919 |
aggctaaaatatgattttagtccctgcaaatatg |
21509886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 28497616 - 28497571
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
28497571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 33652193 - 33652238
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| |||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagtttta |
33652238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35143845 - 35143796
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||| |||||||||||||| |
|
|
| T |
35143845 |
aggctaaaatatggttttaatccgtgtaaatatgcctcgttttggtttta |
35143796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 379
Target Start/End: Original strand, 36588216 - 36588253
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
36588216 |
ttaaaaggctaaaatatgcttttggtccctgcaaatat |
36588253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 380
Target Start/End: Complemental strand, 1163274 - 1163242
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
1163274 |
ggctaaaatatggttttagtccatgcaaatatg |
1163242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 343 - 391
Target Start/End: Original strand, 2811430 - 2811478
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttgg |
391 |
Q |
| |
|
|||||| ||||||||||||||| ||| ||| ||||||| |||||||||| |
|
|
| T |
2811430 |
taaaagactaaaatatggttttggtctctgtaaatatgcttcgttttgg |
2811478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 349 - 389
Target Start/End: Complemental strand, 23360735 - 23360695
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgtttt |
389 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
23360735 |
gctaaaatatgattttaatccctgcaaatatgttttgtttt |
23360695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 380
Target Start/End: Complemental strand, 30969717 - 30969685
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatg |
30969685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 372
Target Start/End: Complemental strand, 32040344 - 32040316
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctg |
372 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32040344 |
aaaaggctaaaatatggttttagtccctg |
32040316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 44998263 - 44998215
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| || || ||||||||| |||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggtttta |
44998215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 5e-20; HSPs: 162)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 38496784 - 38496734
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38496784 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
38496734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 31037742 - 31037685
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
31037742 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctctgt |
31037685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 45501 - 45449
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttaatctctg |
45449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 25562000 - 25561944
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25562000 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatctctg |
25561944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 26133416 - 26133365
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26133416 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26133365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 4736544 - 4736494
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4736544 |
aaggctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
4736494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 18046032 - 18046086
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
18046032 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
18046086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 38786157 - 38786207
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38786157 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
38786207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 404
Target Start/End: Original strand, 40029139 - 40029197
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
40029139 |
aaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgt |
40029197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 1381242 - 1381295
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
1381242 |
taaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1381295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 20690732 - 20690789
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
20690732 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
20690789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 21124908 - 21124961
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
21124908 |
taaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
21124961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 28863505 - 28863558
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28863505 |
taaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28863558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 32108807 - 32108864
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
32108807 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgt |
32108864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 36577721 - 36577770
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36577721 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
36577770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 39379611 - 39379562
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39379611 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
39379562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 5614162 - 5614214
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
5614162 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
5614214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 10743720 - 10743772
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10743720 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10743772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 16038373 - 16038425
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16038373 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16038425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 29366949 - 29366901
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29366901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 2217491 - 2217542
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2217491 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2217542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 348 - 399
Target Start/End: Complemental strand, 6118499 - 6118448
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatc |
6118448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 7075569 - 7075620
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7075569 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7075620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 18258530 - 18258479
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
18258530 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
18258479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 18633596 - 18633647
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18633596 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 36578086 - 36578035
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36578086 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
36578035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 404
Target Start/End: Complemental strand, 38452399 - 38452340
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
38452399 |
aaagcctaaaatatggttttggtccctgcaaatatgtctcgttttgattttaatctctgt |
38452340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 293822 - 293876
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
293822 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
293876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 4203454 - 4203504
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4203454 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4203504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 19565465 - 19565515
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
19565465 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19565515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 29172888 - 29172838
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29172888 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29172838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 29693092 - 29693042
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29693092 |
aaggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
29693042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 35167167 - 35167117
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35167167 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35167117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 35876686 - 35876736
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
35876686 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
35876736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 2217855 - 2217806
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2217806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 3850600 - 3850551
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3850600 |
aggctgaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
3850551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 4203771 - 4203722
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
4203771 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
4203722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 5614531 - 5614482
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5614531 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5614482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 5917125 - 5917174
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
5917125 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
5917174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 5950175 - 5950224
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5950175 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5950224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 9179592 - 9179641
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggtttta |
9179641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 9179925 - 9179872
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
9179925 |
taaaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9179872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 10744055 - 10744006
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
10744055 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
10744006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 14318044 - 14318093
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
14318044 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
14318093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 18046349 - 18046300
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18046349 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18046300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 19685016 - 19685065
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
19685016 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19685065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 23381949 - 23381998
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
23381949 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggtttta |
23381998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 24781988 - 24782037
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
24781988 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggtttta |
24782037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 25779163 - 25779114
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
25779163 |
aggctaaaatatggttttagtccctgcaaatatgcttcattttggtttta |
25779114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 29692743 - 29692792
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29692743 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29692792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 29875726 - 29875677
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29875726 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29875677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 30800493 - 30800542
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30800493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30800542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 30800851 - 30800802
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30800851 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30800802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35877053 - 35877004
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35877053 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35877004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 45138 - 45186
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 2032940 - 2032892
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggtttta |
2032892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 6912861 - 6912809
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
6912861 |
aaaagactaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
6912809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 10408924 - 10408976
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
10408924 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10408976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 10409327 - 10409271
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
10409327 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctg |
10409271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 18633961 - 18633913
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 404
Target Start/End: Complemental strand, 22551323 - 22551263
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
22551323 |
aaaaagctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtctctgt |
22551263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 25561705 - 25561753
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
25561753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 28550827 - 28550875
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28550875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 28863838 - 28863790
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28863790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 30888160 - 30888208
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
30888208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 33336026 - 33335978
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
33335978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 35928060 - 35928112
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
35928060 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35928112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 35928458 - 35928410
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35928410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 38962806 - 38962854
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
38962854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 40029497 - 40029449
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
40029449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 40167782 - 40167834
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40167782 |
aaaaggctaaagtatggttttagtccctgcaaatatgcctcgttttggtttta |
40167834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 404
Target Start/End: Original strand, 42553642 - 42553698
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgt |
42553698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 403
Target Start/End: Original strand, 2636669 - 2636724
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtctctg |
2636724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 404
Target Start/End: Complemental strand, 27916767 - 27916708
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
27916767 |
aaaggttaaaatatggttttattccctgcaaatatgcctcgttttggttttagtctctgt |
27916708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 29172524 - 29172571
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29172571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 37271709 - 37271658
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
37271709 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
37271658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 38170511 - 38170562
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
38170511 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38170562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 1381613 - 1381563
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
1381613 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1381563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 5917462 - 5917412
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5917462 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5917412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 11799127 - 11799177
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
11799127 |
aaggctaaaatatggttttagtccctgcaaatatgcattgttttggtttta |
11799177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 13990897 - 13990847
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13990897 |
aaggctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
13990847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 15635709 - 15635659
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
15635709 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttta |
15635659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 404
Target Start/End: Complemental strand, 16038738 - 16038684
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgt |
16038684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 19685382 - 19685332
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
19685382 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19685332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 20660946 - 20660996
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
20660946 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20660996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 29151853 - 29151803
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
29151853 |
aaggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
29151803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 35166909 - 35166959
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
35166909 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
35166959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 35609635 - 35609589
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35609589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 396
Target Start/End: Complemental strand, 40168014 - 40167960
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||| |||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
40168014 |
ttaataggctaaaatattgttttagtccatgcaaatatgtctcgttttggtttta |
40167960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 40764413 - 40764463
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
40764413 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
40764463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 348 - 398
Target Start/End: Original strand, 42994068 - 42994118
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaat |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgattttaat |
42994118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 1105149 - 1105100
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
1105149 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1105100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 11799459 - 11799410
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggtttta |
11799410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 17070864 - 17070815
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
17070864 |
aggctaaaatatggttttagtccctacaaatatgtctcgttttcgtttta |
17070815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 19565832 - 19565783
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
19565832 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19565783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 24443745 - 24443696
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24443745 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24443696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 34125306 - 34125355
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34125306 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
34125355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35166159 - 35166110
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35166159 |
aggctataatatggttttagtccctgcaaaaatgtctcgttttggtttta |
35166110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 42207241 - 42207290
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
42207241 |
aggctaaaatatggttttagtccttgtaaatatgtctcgttttggtttta |
42207290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 2636997 - 2636945
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
2636997 |
aaaaagctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2636945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 6912497 - 6912545
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
6912545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 388
Target Start/End: Original strand, 17070531 - 17070575
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttt |
388 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
17070531 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttt |
17070575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 399
Target Start/End: Original strand, 18286431 - 18286479
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggttttaatc |
18286479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 346 - 394
Target Start/End: Original strand, 20416358 - 20416406
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||| |||||||| |
|
|
| T |
20416358 |
aaggctaaaatatggttttcgtccctgcaaatatgtctcgctttggttt |
20416406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 20661311 - 20661263
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggtttta |
20661263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 21050913 - 21050865
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgatttta |
21050865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 23382297 - 23382249
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
23382249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 26133183 - 26133231
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
26133231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 395
Target Start/End: Original strand, 3850299 - 3850346
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt |
3850346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 9532538 - 9532487
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
9532538 |
aaaggttaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9532487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 27850377 - 27850326
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||| |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
27850377 |
aaagactaaaatatgattttagtctctgcaaatatgtctcgttttggtttta |
27850326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 27916462 - 27916509
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggtttta |
27916509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 40764783 - 40764732
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
40764783 |
aaaggctaaaatatggttttgctccctgcaaatatgcctcgttttggtttta |
40764732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 15635374 - 15635424
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| | |||||||||||| |
|
|
| T |
15635374 |
aaggataaaatatggttttagtccatgcaaatatgtcttgttttggtttta |
15635424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 18258160 - 18258210
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
18258160 |
aaggctaaaatatggttttggtccctgcaaatatggctcattttggtttta |
18258210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 18286743 - 18286693
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18286743 |
aaggctaaaaaatggttttagtccctgcaaatatacctcgttttggtttta |
18286693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 20683745 - 20683795
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
20683745 |
aaggctaaaatatggttttagtctctgcaaatatgcatcgttttgatttta |
20683795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 20986091 - 20986041
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
20986091 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
20986041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 24443378 - 24443428
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
24443378 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
24443428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 28213371 - 28213421
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
28213371 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
28213421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 28871996 - 28871946
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
28871996 |
aaggctaaattatggttttggtccctgcaaatatgcctcgttttggtttta |
28871946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 29875398 - 29875448
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
29875398 |
aaggctaaaatatgattttaatccctgcaaatatgcctcgttttggtttta |
29875448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 34125634 - 34125584
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| || ||||||||||| |
|
|
| T |
34125634 |
aaggctaaaatatggttttagtccctgtaaatatgcctcattttggtttta |
34125584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 1104857 - 1104906
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
1104857 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
1104906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 3851330 - 3851281
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
3851330 |
aggctaaaatatggttttagtccctcaaaatatgtctcgttttgatttta |
3851281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 350 - 395
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 20985728 - 20985773
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20985773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 36278080 - 36278129
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
36278080 |
aggctaaaatatggttttgatccctgcaaatatgtttcattttagtttta |
36278129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 37271358 - 37271407
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
37271358 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
37271407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 345 - 394
Target Start/End: Complemental strand, 38182090 - 38182041
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
38182090 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 345 - 394
Target Start/End: Original strand, 38189041 - 38189090
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
38189041 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 345 - 394
Target Start/End: Complemental strand, 38209316 - 38209267
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
38209316 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 345 - 394
Target Start/End: Original strand, 38216266 - 38216315
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
38216266 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 39379242 - 39379287
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
39379287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 5104001 - 5103953
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| || ||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggtttta |
5103953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 15916286 - 15916334
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggtttta |
15916334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 21050575 - 21050623
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgatttta |
21050623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 29151516 - 29151564
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgatttta |
29151564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 35609303 - 35609351
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggtttta |
35609351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 36973353 - 36973401
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||| || ||||||||| |||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggtttta |
36973401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 36973710 - 36973662
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| |||||||| ||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgatttta |
36973662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 40038493 - 40038545
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
40038493 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttgattttaatc |
40038545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 404
Target Start/End: Complemental strand, 40038858 - 40038802
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgt |
40038802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 26071619 - 26071568
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26071619 |
aaaggttaaaatatgattttgatccctgcaaatatgtctcgttttggtttta |
26071568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 1287047 - 1286997
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| ||||||| |||||||| || ||||||||||| |
|
|
| T |
1287047 |
aaggttaaaatatggttttggtccctgtaaatatgtctcattttggtttta |
1286997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 380
Target Start/End: Original strand, 16616370 - 16616400
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatg |
16616400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 404
Target Start/End: Original strand, 31037397 - 31037451
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||| ||||| ||||||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgattttagtctctgt |
31037451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 38554750 - 38554805
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
38554750 |
aggctaaaatatggttttgatccctgcaaata--tctcgttttggttttagtctctgt |
38554805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 392
Target Start/End: Original strand, 4736204 - 4736249
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggt |
392 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
4736204 |
aggctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 12144906 - 12144955
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| || ||||||||||| |
|
|
| T |
12144906 |
aggctaaaatatggtttttgtccctgtaaatatgcctctttttggtttta |
12144955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 20418013 - 20417968
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| |||||||||||| |||||||| ||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgatttta |
20417968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 26071290 - 26071339
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| || ||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggtttta |
26071339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 28108159 - 28108114
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggtttta |
28108114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 28871640 - 28871685
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
28871640 |
taaaatatgattttggtccctgcaaatatccttcgttttggtttta |
28871685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 42596814 - 42596769
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagtttta |
42596769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 1286682 - 1286730
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| || |||||| |||||||| |||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggtttta |
1286730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 379
Target Start/End: Complemental strand, 3938120 - 3938088
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3938120 |
aggctaaaatatgcttttagtccctgcaaatat |
3938088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 9588611 - 9588563
Alignment:
| Q |
349 |
gctaaaatatggttttag-tccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| |||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggtttta |
9588563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 404
Target Start/End: Complemental strand, 30888435 - 30888375
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||| ||||||| | | |||||| | |||||||||||||| ||||||| |
|
|
| T |
30888435 |
aaaaggctaaaatatgattttagtatccgtaaatatatctcgttttggttttagtctctgt |
30888375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 343 - 379
Target Start/End: Complemental strand, 34911892 - 34911856
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
34911892 |
taaaaggctaaaatatgattttggtccctgcaaatat |
34911856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 376
Target Start/End: Original strand, 35165937 - 35165965
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaa |
376 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35165937 |
ggctaaaatatggttttagtccctgcaaa |
35165965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 372
Target Start/End: Original strand, 37090414 - 37090442
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctg |
372 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37090414 |
aaaaggctaaaatatggttttagtccctg |
37090442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 1306 - 1359
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1306 |
taaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
1359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 1647 - 1596
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
1647 |
aaaggctaaaatatgaatttagtccctgcaaatatgcctcgttttggtttta |
1596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 2e-19; HSPs: 215)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 20611018 - 20611075
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
20611018 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctg |
20611075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 346 - 403
Target Start/End: Original strand, 39288571 - 39288628
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
39288571 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctg |
39288628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 340 - 396
Target Start/End: Original strand, 39436710 - 39436766
Alignment:
| Q |
340 |
tgttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39436710 |
tgtttaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39436766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 4814538 - 4814588
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4814538 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 5345691 - 5345641
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5345691 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
5345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 22008524 - 22008574
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22008524 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22008574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 22016042 - 22016092
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22016042 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22016092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 342 - 396
Target Start/End: Complemental strand, 34238921 - 34238867
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
34238921 |
ttaaaaggctaaaatatggttttagtccccgcaaatatgcttcgttttggtttta |
34238867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 29490744 - 29490687
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
29490744 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
29490687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 30130157 - 30130206
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30130157 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
30130206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 34238597 - 34238646
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34238597 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
34238646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 51834943 - 51834894
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51834943 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
51834894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 4950033 - 4950085
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4950033 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4950085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 12741275 - 12741223
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
12741275 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12741223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 21159449 - 21159501
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
21159449 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
21159501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 37507226 - 37507174
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37507226 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37507174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 404
Target Start/End: Complemental strand, 40979714 - 40979654
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
40979714 |
aaaaggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgt |
40979654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 404
Target Start/End: Complemental strand, 50261936 - 50261880
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
50261936 |
ggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtctctgt |
50261880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 53701663 - 53701615
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
53701615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 404
Target Start/End: Complemental strand, 46186774 - 46186715
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
46186774 |
aaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgt |
46186715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 474042 - 474092
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
474042 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
474092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 1721454 - 1721404
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
1721454 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
1721404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 4513261 - 4513311
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4513261 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4513311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 4513622 - 4513572
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
4513622 |
aaggctaaaatatggttttactccctgcaaatatgtctcgttttggtttta |
4513572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 354 - 396
Target Start/End: Complemental strand, 8510523 - 8510481
Alignment:
| Q |
354 |
aatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggtttta |
8510481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 14772209 - 14772259
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
14772209 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
14772259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 20612900 - 20612850
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20612900 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
20612850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 26799882 - 26799936
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
26799882 |
ttaaaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
26799936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 28427610 - 28427560
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28427610 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28427560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 29525103 - 29525153
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
29525103 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttagtttta |
29525153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 39437111 - 39437061
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39437111 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
39437061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 47336226 - 47336276
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
47336226 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
47336276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 51834606 - 51834656
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51834606 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
51834656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 474409 - 474360
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
474409 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
474360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 350 - 399
Target Start/End: Complemental strand, 2486900 - 2486851
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatc |
2486851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 3151749 - 3151798
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3151749 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3151798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 3152112 - 3152063
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3152112 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3152063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 3830517 - 3830468
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3830517 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3830468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 12740906 - 12740955
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
12740906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12740955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 15286155 - 15286204
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggtttta |
15286204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 21159818 - 21159769
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21159818 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
21159769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 22155928 - 22155977
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
22155928 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
22155977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 28427244 - 28427293
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
28427244 |
aggctaaaatatggttttagttcctgcaaatatgtctcgttttggtttta |
28427293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 29446207 - 29446158
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
29446207 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
29446158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 31869957 - 31869908
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
31869957 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagtttta |
31869908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 35177250 - 35177303
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35177250 |
taaaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
35177303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 35498415 - 35498472
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
35498415 |
aggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctgt |
35498472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 37506866 - 37506915
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37506866 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37506915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 351 - 404
Target Start/End: Original strand, 45161116 - 45161169
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgt |
45161169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 46622130 - 46622081
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
46622130 |
aggctaaaatatggttttggtccttgcaaatatgtttcgttttggtttta |
46622081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 46901103 - 46901152
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
46901103 |
aggctaaaatatggttttagtctctgcaaatatgtatcgttttggtttta |
46901152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 47336582 - 47336533
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
47336582 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
47336533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 51550447 - 51550398
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
51550447 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
51550398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 54608864 - 54608815
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
54608864 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
54608815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 4034717 - 4034765
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4034765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 10976978 - 10977026
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10977026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 13584371 - 13584319
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
13584371 |
aaaaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
13584319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 14633541 - 14633593
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14633541 |
aaaagactaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14633593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 15979338 - 15979386
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
15979386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 25710870 - 25710822
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25710822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 26089730 - 26089778
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
26089778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 26090078 - 26090030
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
26090030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 404
Target Start/End: Original strand, 30424628 - 30424684
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||| |||||| ||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtctctgt |
30424684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 30552482 - 30552430
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
30552482 |
aaaaggctaaaatatcgttttagtccatgcaaatatgtctcgttttggtttta |
30552430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 31480132 - 31480184
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31480132 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
31480184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 40169340 - 40169392
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
40169340 |
aaaaggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttta |
40169392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 40169654 - 40169606
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
40169606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 43441270 - 43441318
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
43441318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 44802282 - 44802330
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggtttta |
44802330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 51759815 - 51759867
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
51759815 |
aaaaggctaaaatatggttctagttcctgcaaatatgtctcgttttggtttta |
51759867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 54608514 - 54608566
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
54608514 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
54608566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 863655 - 863604
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
863655 |
aaaggttaaaatatggttttggtccctgcaaatatgtttcgttttgatttta |
863604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 14633892 - 14633841
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
14633892 |
aaaggctaaattatggttttagtccctgcaaatatgtcttgttttggtttta |
14633841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 22156292 - 22156245
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22156245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 25615972 - 25616023
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
25615972 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25616023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 40277819 - 40277870
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
40277819 |
aaaggctaaaatgtggttttggtccctgcaaatatgcttcgttttggtttta |
40277870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 43440492 - 43440543
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
43440492 |
aaaggctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
43440543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 47114484 - 47114535
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
47114484 |
aaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
47114535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 52342194 - 52342249
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctct |
402 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
52342194 |
aggctaaaatatggttttggtccctgcaaatatgcctccttttggttttaatctct |
52342249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 395
Target Start/End: Original strand, 53113439 - 53113490
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
53113439 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 349 - 403
Target Start/End: Complemental strand, 3361817 - 3361763
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctg |
3361763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 4814900 - 4814851
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
4814900 |
aaggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggtttta |
4814851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 7518444 - 7518398
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggtttta |
7518398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 9597097 - 9597047
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
9597097 |
aaggctaaaatatggttttgttccctgcaaatatgcttcgttttggtttta |
9597047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 28942907 - 28942857
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
28942907 |
aaggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
28942857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 30268503 - 30268553
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30268503 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
30268553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 35569138 - 35569088
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35569138 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35569088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 45002015 - 45002069
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
45002015 |
ttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
45002069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 404
Target Start/End: Complemental strand, 45006247 - 45006193
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
45006193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 45320981 - 45320931
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
45320981 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
45320931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 45521838 - 45521788
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45521838 |
aaggttaaaatatggttttagtctttgcaaatatgtttcgttttggtttta |
45521788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 46751269 - 46751319
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
46751269 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
46751319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 47005152 - 47005202
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
47005152 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttagtttta |
47005202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 50196301 - 50196347
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
50196347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 3387609 - 3387556
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
3387609 |
taaaaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggtttta |
3387556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 3830133 - 3830182
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
3830133 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
3830182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 9262156 - 9262107
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
9262156 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
9262107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 9603920 - 9603863
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
9603920 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttattctctgt |
9603863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 12673639 - 12673692
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
12673639 |
taaaaggctaaaatatagttttagtccctgtaaatatgcctcgttttggtttta |
12673692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 15979702 - 15979653
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
15979702 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
15979653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 348 - 404
Target Start/End: Original strand, 18175791 - 18175845
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||| |||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccctgt |
18175845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 25710509 - 25710558
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
25710509 |
aggctcaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
25710558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 28452377 - 28452328
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
28452377 |
aggctaaaatatggttttggtccctacaaatatgcttcgttttggtttta |
28452328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 28552384 - 28552335
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
28552384 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28552335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 28942524 - 28942573
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
28942524 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
28942573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 29955667 - 29955618
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29955667 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29955618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 30004822 - 30004773
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30004822 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30004773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 30128283 - 30128332
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
30128283 |
aggctaaaatatggttttggtccctgcaaacatgtctcgttttggtttta |
30128332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 35936778 - 35936831
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||||||| |
|
|
| T |
35936778 |
aaggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatc |
35936831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 39288899 - 39288850
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
39288899 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
39288850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 43441608 - 43441555
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
43441608 |
taaaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
43441555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 49670803 - 49670754
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccc-tgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggtttta |
49670754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 51500686 - 51500637
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
51500637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 51550081 - 51550130
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
51550081 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
51550130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 275833 - 275785
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
275833 |
ggctaaaatatgattttagtccctgtaaatatgcttcgttttggtttta |
275785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 8510214 - 8510262
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggtttta |
8510262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 9863404 - 9863356
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
9863356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 10977345 - 10977293
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
10977345 |
aaaaggctaaaatatggatttaatccctgcaaatatgcctcgttttggtttta |
10977293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 15016388 - 15016436
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
15016436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 16123139 - 16123187
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
16123187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 22008890 - 22008842
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
22008842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 380
Target Start/End: Complemental strand, 26800173 - 26800137
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26800173 |
aaaaggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 28418904 - 28418852
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
28418904 |
aaaaagctaaaatatggttttggtccctgcaaatatgttttgttttgatttta |
28418852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 29445954 - 29446002
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
29446002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 32119588 - 32119536
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
32119588 |
aaaaggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
32119536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 404
Target Start/End: Complemental strand, 39072213 - 39072157
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| |||||||| |||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgt |
39072157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 40370589 - 40370541
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
40370541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 45002389 - 45002337
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
45002389 |
aaaaggctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
45002337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 45313863 - 45313815
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgatttta |
45313815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 396
Target Start/End: Complemental strand, 48924248 - 48924192
Alignment:
| Q |
340 |
tgttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
48924248 |
tgttataaggctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
48924192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 49323782 - 49323830
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
49323830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 8940528 - 8940477
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
8940528 |
aaaggttaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
8940477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 19656538 - 19656589
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
19656538 |
aaaggctaaaatatggttttagtccatgcaaatatgcctcgttttgatttta |
19656589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 19844584 - 19844533
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
19844584 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
19844533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 347 - 394
Target Start/End: Complemental strand, 39132907 - 39132860
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| | ||||||| |
|
|
| T |
39132907 |
aggctaaaatatggttttggtccctgcaaatatgtttcatattggttt |
39132860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 344 - 379
Target Start/End: Original strand, 44506578 - 44506613
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44506578 |
aaaaggctaaaatatggttttagtccctgcaaatat |
44506613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 51760117 - 51760070
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
51760070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 3387263 - 3387313
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3387263 |
aaggttaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
3387313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 7518088 - 7518138
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
7518088 |
aaggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgtttta |
7518138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 16679678 - 16679724
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggtttta |
16679724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 21553887 - 21553937
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
21553887 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
21553937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 29955300 - 29955346
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
29955346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 30004454 - 30004500
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
30004500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 31869596 - 31869642
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggtttta |
31869642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 38232239 - 38232289
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
38232239 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttgatttta |
38232289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 52342585 - 52342535
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
52342585 |
aaggctaaaatatggtttttgtctctgcaaatatgcctcgttttggtttta |
52342535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 275443 - 275492
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
275443 |
aggctaaaatatggttttagtccctgcaactatgcctcgttttgatttta |
275492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 863280 - 863337
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| ||||||| |||||| ||||||| |
|
|
| T |
863280 |
aggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgt |
863337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 7588317 - 7588374
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| | |||||||||||| ||||||| |
|
|
| T |
7588317 |
aggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtctctgt |
7588374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 9603628 - 9603677
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
9603628 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
9603677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 344 - 377
Target Start/End: Complemental strand, 10792974 - 10792941
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaat |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10792974 |
aaaaggctaaaatatggttttagtccctgcaaat |
10792941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 11463227 - 11463280
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
11463227 |
taaaaagctaaaatatggttttggttcctgcaaatatgcctcgttttggtttta |
11463280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 13514578 - 13514529
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| || ||||||||||||| |||||||||||||| |
|
|
| T |
13514578 |
aggctaaaatatgattttggtacctgcaaatatgtctcgttttggtttta |
13514529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 20757403 - 20757448
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
20757448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 20757776 - 20757719
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||| ||||| |||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
20757776 |
aggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtctctgt |
20757719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 404
Target Start/End: Complemental strand, 20907454 - 20907401
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||| |||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgt |
20907401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 345 - 390
Target Start/End: Original strand, 25353196 - 25353241
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttg |
390 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25353196 |
aaaggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 27681683 - 27681626
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
27681683 |
aggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgt |
27681626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 28452146 - 28452195
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| | |||||||||||| |
|
|
| T |
28452146 |
aggctaaaatatggttttggtccttgcaaatatgtcttgttttggtttta |
28452195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 28552020 - 28552069
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
28552020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgtttta |
28552069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 30034473 - 30034424
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
30034473 |
aggctaaaatatggttttgctccttgcaaatatgtctcgttttggtttta |
30034424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 30106221 - 30106172
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
30106221 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggtttta |
30106172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 32119219 - 32119268
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
32119219 |
aggctaaaatatagttttggtccctgcaaatatgtctcgttttagtttta |
32119268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 339 - 396
Target Start/End: Original strand, 35533270 - 35533327
Alignment:
| Q |
339 |
atgttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| ||| ||||||||||||||| ||| |||||||||||| | |||||||||||| |
|
|
| T |
35533270 |
atgttataagactaaaatatggttttggtctctgcaaatatgtcttgttttggtttta |
35533327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 404
Target Start/End: Original strand, 36672966 - 36673019
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| | |||||||||||| ||||||| |
|
|
| T |
36672966 |
taaaatatggttttggtctctgcaaatatgtcttgttttggttttagtctctgt |
36673019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 40545563 - 40545612
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
40545563 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttagtttta |
40545612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 47005520 - 47005471
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
47005520 |
aggctaaaatatggttttggtccctgcaaatattcctcgttttggtttta |
47005471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 49324143 - 49324098
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
49324098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 50196658 - 50196609
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
50196658 |
aggctaaaatatggttttagtccctacaaatatgcctcgtttttgtttta |
50196609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 4035053 - 4035005
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
4035005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 7957226 - 7957178
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggtttta |
7957178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 9261789 - 9261837
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
9261837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 31480500 - 31480452
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggtttta |
31480452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 40370285 - 40370333
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagtttta |
40370333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 46186405 - 46186457
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
46186405 |
aaaatgctaaaatatgattttagtccctgcaaatatgcctcgttttgatttta |
46186457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 9596759 - 9596806
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggtttta |
9596806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 25610129 - 25610082
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
25610082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 35565505 - 35565556
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
35565505 |
aaaggctaaaatatggttttgttccctgcaaatatacctcgttttggtttta |
35565556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 44802551 - 44802504
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggt |
392 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
44802551 |
aaaggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 47901797 - 47901848
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
47901797 |
aaaggttaaaatatggttttagtctctggaaatatgcatcgttttggtttta |
47901848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 50008921 - 50008968
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
50008921 |
gctagaatatggttttggtccctgcaaatatgttttattttggtttta |
50008968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 51500397 - 51500452
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctct |
402 |
Q |
| |
|
|||||||||||||||| ||||| ||| ||||||| |||||||||||||| ||||| |
|
|
| T |
51500397 |
aggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtctct |
51500452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 53632500 - 53632551
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
53632500 |
aaaggataaaatatggttttagtccctataaatatggttcgttttagtttta |
53632551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 2486581 - 2486627
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggtttta |
2486627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 4322191 - 4322141
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||| ||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
4322191 |
aaggttaaaatatagttttggtccctgcaaatatgtcttgttttggtttta |
4322141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 380
Target Start/End: Complemental strand, 26273826 - 26273792
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26273826 |
aaggctaaaatatggttttagtcccagcaaatatg |
26273792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 29686542 - 29686592
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||||||| | |||||||||||| |
|
|
| T |
29686542 |
aaggctagaatatggttttggtccatgcaaatatgtcttgttttggtttta |
29686592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 30130506 - 30130456
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| || ||||||||||| |
|
|
| T |
30130506 |
aaggctcaaatatggttttagtcactgcaaatatgcctcattttggtttta |
30130456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 354 - 404
Target Start/End: Complemental strand, 38232594 - 38232544
Alignment:
| Q |
354 |
aatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||| || ||||||||||||| |||||||||||| | ||||||| |
|
|
| T |
38232594 |
aatatggttttggtacctgcaaatatgtctcgttttggtttcagtctctgt |
38232544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 379
Target Start/End: Original strand, 39819309 - 39819343
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
39819309 |
aaagcctaaaatatggttttagtccctgcaaatat |
39819343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 43440785 - 43440739
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggtttta |
43440739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 403
Target Start/End: Complemental strand, 47114741 - 47114699
Alignment:
| Q |
361 |
ttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
47114741 |
tttttgtccctgcaaatatgtctcgttttggttttgatctctg |
47114699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 1721092 - 1721137
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| || ||||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggtttta |
1721137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 4321945 - 4322002
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||| || |||||||||||||| |||| |
|
|
| T |
4321945 |
aggctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctgt |
4322002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 8555305 - 8555260
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggtttta |
8555260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 9863050 - 9863094
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgc-aatatgcctcgttttggtttta |
9863094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 20405224 - 20405175
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || ||||| |||||| |
|
|
| T |
20405224 |
aggctaaaatatggttttggtccctgcaaatatactttgttttagtttta |
20405175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 358 - 395
Target Start/End: Complemental strand, 25610061 - 25610024
Alignment:
| Q |
358 |
tggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggtttt |
25610024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 399
Target Start/End: Original strand, 30034109 - 30034158
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatc |
30034158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 404
Target Start/End: Complemental strand, 35177563 - 35177510
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||| |||||||||||||| |||| |
|
|
| T |
35177563 |
taaaatatggttttcatccttgcaaatatgcttccttttggttttaatccctgt |
35177510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35407791 - 35407742
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | ||||| |||||| |
|
|
| T |
35407791 |
aggctaaaatatggttttgatccctgcaaatatgtcttgtttttgtttta |
35407742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 40545836 - 40545791
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||| |||||||||||||||| || ||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggtttta |
40545791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 45005889 - 45005934
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgatttta |
45005934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 47114804 - 47114755
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||| ||||||||| |||||| |
|
|
| T |
47114804 |
aggctaaaatatagttttggtccttgcaaatatatttcgttttagtttta |
47114755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 379
Target Start/End: Complemental strand, 53122532 - 53122499
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
53122532 |
aaggctaaaatatgcttttagtccctgcaaatat |
53122499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 10778366 - 10778418
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
10778366 |
aaaaggttaaaatatggttttagtttctgcaaatatgcctcgttttgatttta |
10778418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 20644505 - 20644553
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| || ||||| ||||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgatttta |
20644553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 379
Target Start/End: Original strand, 20807800 - 20807828
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20807800 |
taaaatatggttttagtccctgcaaatat |
20807828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 29678020 - 29678072
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
29678020 |
aaaaggctaaaatatagttttggtctttgcaaatatgcctcgttttggtttta |
29678072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 30426226 - 30426179
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| ||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagt-cctgcaaatatgcctcgttttgatttta |
30426179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 379
Target Start/End: Complemental strand, 39820664 - 39820632
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
39820664 |
aggctaaaatatggttttggtccctgcaaatat |
39820632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 46724906 - 46724854
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||| || |||||||||||||| |||||| ||||| |
|
|
| T |
46724906 |
aaaaagctaaaatatggttttgatctctgcaaatatgttttgttttgatttta |
46724854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 379
Target Start/End: Complemental strand, 47433869 - 47433837
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
47433869 |
aggctaaaatatggttttggtccctgcaaatat |
47433837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 47902145 - 47902097
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
47902145 |
ggctaaaatatagttttagtccccgcaaatatgcattgttttggtttta |
47902097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 399
Target Start/End: Original strand, 49670477 - 49670525
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||| ||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggttttaatc |
49670525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 8e-19; HSPs: 179)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 1974009 - 1974057
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
1974057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 44344793 - 44344741
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44344793 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
44344741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 404
Target Start/End: Complemental strand, 8555802 - 8555743
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8555802 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
8555743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 404
Target Start/End: Complemental strand, 34878128 - 34878069
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34878128 |
aaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttaatctctgt |
34878069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 6108329 - 6108382
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6108329 |
taaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
6108382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 23816669 - 23816726
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
23816669 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgt |
23816726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 39832905 - 39832954
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39832905 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39832954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 44509059 - 44509006
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44509059 |
taaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44509006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 13769774 - 13769822
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13769822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 14739008 - 14738956
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
14739008 |
aaaaggctaaaatatggttttagtccctgcaaatatgcttcgttttgatttta |
14738956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 19561450 - 19561402
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19561402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 404
Target Start/End: Original strand, 21223405 - 21223461
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgt |
21223461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 23399980 - 23399928
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
23399980 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
23399928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 27458395 - 27458447
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
27458395 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
27458447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 347 - 403
Target Start/End: Complemental strand, 30709645 - 30709589
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
30709645 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctg |
30709589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 400
Target Start/End: Original strand, 32189076 - 32189128
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatct |
400 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttaatct |
32189128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 35210515 - 35210467
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
35210467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 404
Target Start/End: Original strand, 35469880 - 35469936
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgt |
35469936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 46304384 - 46304336
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggtttta |
46304336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 48359075 - 48359027
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
48359027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 5233805 - 5233856
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
5233805 |
aaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
5233856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 8144292 - 8144343
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
8144292 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8144343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 12894405 - 12894354
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12894405 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
12894354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 19757745 - 19757796
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19757745 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19757796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 25092157 - 25092208
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
25092157 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25092208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 37372907 - 37372856
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37372907 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37372856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 350 - 404
Target Start/End: Complemental strand, 6847117 - 6847063
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtctctgt |
6847063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 28911908 - 28911858
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28911908 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28911858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 35837922 - 35837972
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35837922 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35837972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 46648718 - 46648664
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
46648718 |
aaaggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttaatc |
46648664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 1614558 - 1614607
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
1614558 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1614607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 17999722 - 17999673
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17999722 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
17999673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 19783814 - 19783863
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19783814 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
19783863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 25988384 - 25988433
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
25988384 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25988433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 31310364 - 31310421
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
31310364 |
aggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgt |
31310421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 351 - 404
Target Start/End: Complemental strand, 31503780 - 31503727
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtctctgt |
31503727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35838338 - 35838289
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35838338 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35838289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 45073313 - 45073370
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
45073313 |
aggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgt |
45073370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 46759657 - 46759706
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
46759657 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
46759706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 1006835 - 1006883
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1006883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 6509204 - 6509256
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
6509204 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttcgtttta |
6509256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 7431951 - 7431999
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7431999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 14543706 - 14543758
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
14543706 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
14543758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 19561154 - 19561202
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19561202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 25547490 - 25547442
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
25547442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 346 - 394
Target Start/End: Complemental strand, 31310681 - 31310633
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31310681 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 404
Target Start/End: Original strand, 31732101 - 31732157
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgt |
31732157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 352 - 396
Target Start/End: Original strand, 37372441 - 37372485
Alignment:
| Q |
352 |
aaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
37372485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 44403249 - 44403201
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
44403201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 44508720 - 44508768
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44508768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 48854074 - 48854022
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
48854074 |
aaaaggctaaaatatgattttgatccctgcaaatatgtttcgttttggtttta |
48854022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 1614907 - 1614856
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
1614907 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1614856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 3975546 - 3975597
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3975546 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3975597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 5234207 - 5234156
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
5234207 |
aaaggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5234156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 9659692 - 9659641
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
9659692 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
9659641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 348 - 395
Target Start/End: Original strand, 17999465 - 17999512
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
17999512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 18022368 - 18022415
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggtttta |
18022415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 25988752 - 25988701
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
25988752 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25988701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 30223458 - 30223509
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
30223458 |
aaaggctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
30223509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 343 - 394
Target Start/End: Original strand, 30352555 - 30352606
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30352555 |
taaaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
30352606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 39439032 - 39438981
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
39439032 |
aaaggctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
39438981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 43300613 - 43300660
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggtttta |
43300660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 44568693 - 44568642
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
44568693 |
aaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
44568642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 404
Target Start/End: Original strand, 1559341 - 1559399
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
1559341 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgt |
1559399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 6509472 - 6509422
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
6509472 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
6509422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 13770083 - 13770033
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13770083 |
aaggctaaaatatggttttagtccctgcaaatatgccccgttttggtttta |
13770033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 17854151 - 17854197
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
17854197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 21223750 - 21223700
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21223750 |
aaggctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
21223700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 44344454 - 44344508
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| |||||| |||||||||| |
|
|
| T |
44344454 |
aaaggctaaaatatggttttagttcccgcaaatatgtctcgtttcggttttaatc |
44344508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 45073643 - 45073593
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45073643 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
45073593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 45228920 - 45228870
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
45228920 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
45228870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 46828942 - 46828992
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
46828942 |
aaggctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
46828992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 3975839 - 3975790
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3975839 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3975790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 8144659 - 8144610
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
8144659 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
8144610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 11767276 - 11767227
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
11767276 |
aggctaaaatatggttttggtccctgcaaatatgcttcattttggtttta |
11767227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 18022705 - 18022656
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
18022705 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
18022656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 20388273 - 20388322
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
20388273 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
20388322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 23399611 - 23399660
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
23399611 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23399660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 23676135 - 23676180
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
23676180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 23676453 - 23676404
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
23676453 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23676404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 26878072 - 26878023
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26878072 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
26878023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 28262712 - 28262769
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
28262712 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgt |
28262769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 28911576 - 28911625
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
28911576 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
28911625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 29198302 - 29198351
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
29198302 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggtttta |
29198351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 29198663 - 29198614
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29198663 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29198614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35015221 - 35015172
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
35015221 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
35015172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 39719643 - 39719594
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
39719643 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttagtttta |
39719594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 45021857 - 45021808
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
45021857 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
45021808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 48192489 - 48192440
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
48192489 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
48192440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 389
Target Start/End: Complemental strand, 1559708 - 1559664
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgtttt |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1559708 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
1559664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 5308323 - 5308371
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
5308371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 6079805 - 6079857
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
6079805 |
aaaaagctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
6079857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 352 - 404
Target Start/End: Original strand, 6954862 - 6954914
Alignment:
| Q |
352 |
aaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||| |||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtctctgt |
6954914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 10358368 - 10358320
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
10358320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 16853589 - 16853541
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16853541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 404
Target Start/End: Original strand, 18311576 - 18311636
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||| |||||||||||||||||||| || |||||||| |||||||||||||| ||||||| |
|
|
| T |
18311576 |
aaaaagctaaaatatggttttagtctctacaaatatgcctcgttttggttttattctctgt |
18311636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 25092552 - 25092500
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
25092552 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctctttttggtttta |
25092500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 346 - 402
Target Start/End: Complemental strand, 37953053 - 37952997
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctct |
402 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||| | |||||||||||| ||||| |
|
|
| T |
37953053 |
aaggataaaatatggttttagtccctgtaaatatgtcttgttttggttttagtctct |
37952997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 404
Target Start/End: Original strand, 39719353 - 39719409
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||||||||| ||||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgt |
39719409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 39833236 - 39833188
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
39833188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 46759942 - 46759894
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
46759894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 395
Target Start/End: Original strand, 6589021 - 6589068
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
6589068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 351 - 402
Target Start/End: Complemental strand, 18891562 - 18891511
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctct |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtctct |
18891511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 23817037 - 23816990
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggt |
392 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
23817037 |
aaaggctaaaatatggttttagtctctgtaaatatgtctcgttttggt |
23816990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 31732454 - 31732403
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
31732454 |
aaaggctaaaatatggttttagtccatgcaaatatgcctcgttttgatttta |
31732403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 35104075 - 35104126
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35104075 |
aaaggctaaaatataattttggtccctgcaaatatgtctcgttttggtttta |
35104126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 39520395 - 39520446
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||| | ||||||||| |||||||||||||| |
|
|
| T |
39520395 |
aaaggctaaaatatggttttggtccatccaaatatgtctcgttttggtttta |
39520446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 44958509 - 44958458
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
44958509 |
aaaggctaaaatatgattttggtccctacaaatatgtctcgttttggtttta |
44958458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 391
Target Start/End: Original strand, 45021494 - 45021537
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttgg |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgg |
45021537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 48192254 - 48192305
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
48192254 |
aaaggttaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
48192305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 48852441 - 48852492
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
48852441 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgtttta |
48852492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 489074 - 489024
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||| |||||||| ||||| |
|
|
| T |
489074 |
aaggctaaaatatgattttagtctctgcaaatatgtctcgttttgatttta |
489024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 20355768 - 20355722
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
20355768 |
ctaaaatatggttttagtccccgtaaatatgtttcgttttagtttta |
20355722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 24954152 - 24954102
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||||| ||||||||||||||| |
|
|
| T |
24954152 |
aaggttaaaatatggtcttagaccctgcaaatatgattcgttttggtttta |
24954102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 26877676 - 26877726
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
26877676 |
aaggctaaaatatggttttgatctctgcaaatatgtctcgttttggtttta |
26877726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 30223797 - 30223747
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
30223797 |
aaggctaaaatatggttttggtccatgcaaatatgcctcgttttggtttta |
30223747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 32189388 - 32189342
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
32189342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 44402958 - 44403008
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
44402958 |
aaggctaaaatatggttttagtccctgcaaatatgccccattttggtttta |
44403008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 44568324 - 44568374
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
44568324 |
aaggctaaaatatggttttggtccctgcaaatataactcgttttggtttta |
44568374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 46304084 - 46304134
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| |||||||||||||| |
|
|
| T |
46304084 |
aaggctaaaatatgattttagttcctgcaaatatgcctcgttttggtttta |
46304134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 3807863 - 3807912
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
3807863 |
aggctaaaatatagttttggttcctgcaaatatgtctcgttttggtttta |
3807912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 5354767 - 5354816
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
5354767 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
5354816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 9659354 - 9659403
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
9659354 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgatttta |
9659403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 10358000 - 10358049
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| |||||||||||||| |
|
|
| T |
10358000 |
aggctaaaatatgatcttagtccctgcaaatatgcctcgttttggtttta |
10358049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 16940757 - 16940810
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
16940757 |
taaaaggctaacatatggttttggtccctgcaaatatgcctcggtttggtttta |
16940810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 19465981 - 19465933
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
19465981 |
aggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggtttta |
19465933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 380
Target Start/End: Complemental strand, 21554754 - 21554721
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21554754 |
aggctaaaatatggttttagtccctgcaaatatg |
21554721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 25547256 - 25547301
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
25547301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 34877777 - 34877822
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
34877822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35104296 - 35104247
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
35104296 |
aggctcaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35104247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 35665876 - 35665925
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
35665876 |
aggctaaaatatggttttaatccctacaaatatgcctcgttttggtttta |
35665925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 346 - 402
Target Start/End: Complemental strand, 38186763 - 38186706
Alignment:
| Q |
346 |
aaggctaaaatatggttttag-tccctgcaaatatgtttcgttttggttttaatctct |
402 |
Q |
| |
|
|||||||||||||| |||| | ||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
38186763 |
aaggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtctct |
38186706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 39438740 - 39438789
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
39438740 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
39438789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 41054237 - 41054188
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
41054237 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
41054188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 45671217 - 45671262
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagtttta |
45671262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 354 - 394
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
354 |
aatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 1007229 - 1007181
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgatttta |
1007181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 2945849 - 2945797
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||| |||||| |||||||| |||||||||||||| |
|
|
| T |
2945849 |
aaaaggctaaaatatgtttttggtccctacaaatatgcctcgttttggtttta |
2945797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 6589278 - 6589226
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
6589278 |
aaaaggttaaaatatggttttggtccctgcaaatatgccttgttttggtttta |
6589226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 395
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
11766964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 18927091 - 18927043
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| || |||| |||||| |
|
|
| T |
18927091 |
ggctaaaatatagttttagtccctgcaaatatgtctcattttagtttta |
18927043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 21554393 - 21554441
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggtttta |
21554441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 24717532 - 24717484
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||| | ||||||| |||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggtttta |
24717484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 27037593 - 27037641
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
27037641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 351 - 395
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 30352904 - 30352856
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
30352856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 41364884 - 41364932
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| || || ||||||||| |||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggtttta |
41364932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 41365218 - 41365166
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
41365218 |
aaaacgctaaaatatggttttagttcccgcaaatatgcctcgttttggtttta |
41365166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 46829312 - 46829264
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggtttta |
46829264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Complemental strand, 37527421 - 37527374
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| | |||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggtttta |
37527374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 403
Target Start/End: Complemental strand, 3808106 - 3808064
Alignment:
| Q |
361 |
ttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagtctctg |
3808064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 5308688 - 5308639
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
5308688 |
aaggctaaaatatg-ttttagtccctgcaaatatacctcgttttggtttta |
5308639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 30709323 - 30709373
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
30709323 |
aaggttaaaatatgattttagtccctacaaatatgcctcgttttggtttta |
30709373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 37952671 - 37952717
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | ||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggtttta |
37952717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 38186364 - 38186414
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
38186364 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
38186414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 39520732 - 39520682
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||||| |||||||| ||||| |
|
|
| T |
39520732 |
aaggttaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
39520682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 380
Target Start/End: Original strand, 41053840 - 41053874
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41053840 |
aaggctaaaatatggttttggtccctgcaaatatg |
41053874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 43058752 - 43058798
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||||||||||||||||||||| | |||||| ||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgatttta |
43058798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 5355114 - 5355069
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggtttta |
5355069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 6892261 - 6892212
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||| | ||||||| |||| |
|
|
| T |
6892261 |
aggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggttta |
6892212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 404
Target Start/End: Original strand, 12894056 - 12894097
Alignment:
| Q |
363 |
ttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
12894056 |
ttagtccctgcaaatatgcctcgttttggttttaatccctgt |
12894097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 12932784 - 12932735
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
12932784 |
aggctaaaatatgtttttggtccctgcaaatatgcctcgttttgatttta |
12932735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 16941049 - 16941004
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16941004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 376
Target Start/End: Original strand, 35014927 - 35014956
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35014927 |
aggctaaaatatggttttagtccctgcaaa |
35014956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 350 - 395
Target Start/End: Complemental strand, 37159906 - 37159861
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||||||||||||| |
|
|
| T |
37159906 |
ctaaaatatgattttggtttctgcaaatatgtttcgttttggtttt |
37159861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 38486477 - 38486526
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||| ||||||| |||||| |
|
|
| T |
38486477 |
aggctaaaatatgattttggtccctgtaaatatgtctcgttttagtttta |
38486526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 335 - 396
Target Start/End: Complemental strand, 44219692 - 44219631
Alignment:
| Q |
335 |
atatatgttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||| | |||||| |||||||| |||||||||||||||| || ||||||||||||| |
|
|
| T |
44219692 |
atatatgtaataaggcttaaatatggaaatagtccctgcaaatatcttgcgttttggtttta |
44219631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 45671545 - 45671500
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagtttta |
45671500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 351 - 403
Target Start/End: Complemental strand, 7432249 - 7432197
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| ||||| |||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtctctg |
7432197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 19005598 - 19005646
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||| |||||||| ||||| |
|
|
| T |
19005598 |
ggctaaaatatagttttggtccctgtaaatatgtctcgttttgatttta |
19005646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 20388675 - 20388627
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| |||||||| ||||| |
|
|
| T |
20388675 |
ggctaaaatatggttttagtcgctgaaaatatgcctcgttttgatttta |
20388627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 356 - 396
Target Start/End: Original strand, 24953828 - 24953868
Alignment:
| Q |
356 |
tatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggtttta |
24953868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 28263075 - 28263023
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| | |||||| ||||| |
|
|
| T |
28263075 |
aaaagactaaaatatggttttgatccctgcaaatatgtattgttttgatttta |
28263023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 28528905 - 28528953
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| || |||| |||||||| |||||| ||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggtttta |
28528953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 31503416 - 31503468
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| |||||||||||||| | ||||| |||||||| || ||||||||||| |
|
|
| T |
31503416 |
aaaaggttaaaatatggttttggcccctgtaaatatgtctctttttggtttta |
31503468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 379
Target Start/End: Complemental strand, 31848204 - 31848172
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
31848204 |
aggctaaaatatgtttttagtccctgcaaatat |
31848172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 36684532 - 36684584
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaa |
397 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||| | ||||||||||||||| |
|
|
| T |
36684532 |
aaaggctaaaatatggctttgatccatgcaaatatatctcgttttggttttaa |
36684584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 345 - 381
Target Start/End: Complemental strand, 36687266 - 36687230
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgt |
381 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
36687266 |
aaaggctaaaatatgattttggtccctgcaaatatgt |
36687230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 8e-19; HSPs: 141)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 30928677 - 30928729
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30928677 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
30928729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 494756 - 494701
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
494756 |
aaaaagctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatc |
494701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 17771905 - 17771959
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17771905 |
ttaaatggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
17771959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 21385245 - 21385299
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
21385245 |
ttaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
21385299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 23502542 - 23502492
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23502542 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23502492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 404
Target Start/End: Original strand, 26375691 - 26375749
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26375691 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgt |
26375749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 318098 - 318049
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
318098 |
aggctaaaatatggttttaatccctgcaaatatgtttcgttttggtttta |
318049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 10091039 - 10091084
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
10091084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 14655378 - 14655427
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14655378 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
14655427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 25431855 - 25431806
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25431855 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
25431806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 6468306 - 6468358
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
6468306 |
aaaaggctaaaatatggttttagtccctgcaaatatgctttgttttggtttta |
6468358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 404
Target Start/End: Complemental strand, 19296407 - 19296351
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
19296351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 19690389 - 19690441
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
19690389 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19690441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 33801747 - 33801695
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33801747 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33801695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 3356139 - 3356190
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3356139 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
3356190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 15076207 - 15076156
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15076207 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
15076156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 17765006 - 17765057
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
17765006 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17765057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 23770162 - 23770209
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23770209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 24273825 - 24273876
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24273825 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
24273876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 3276356 - 3276306
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
3276356 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3276306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 3968643 - 3968693
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
3968643 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3968693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 7155791 - 7155845
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7155791 |
ttaaaaggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
7155845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 9896639 - 9896589
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
9896639 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
9896589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 11448535 - 11448585
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11448535 |
aaggctaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
11448585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 12757608 - 12757658
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
12757608 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12757658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 24274133 - 24274083
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24274133 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24274083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 34990317 - 34990267
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34990317 |
aaggttaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
34990267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 317811 - 317860
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
317811 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
317860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 1007123 - 1007172
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
1007123 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
1007172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 3414757 - 3414704
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
3414757 |
taaaaggctaaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
3414704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 6412217 - 6412266
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
6412217 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
6412266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 7156161 - 7156112
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7156161 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7156112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 7324189 - 7324144
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
7324144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 8170152 - 8170103
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
8170152 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8170103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 10910965 - 10910916
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
10910965 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10910916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 12176640 - 12176595
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
12176595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 22543719 - 22543670
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
22543719 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
22543670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 24692980 - 24692931
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
24692980 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgctttta |
24692931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 25121497 - 25121448
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
25121497 |
aggctaaaatatggttttggtgcctgcaaatatgtttcgttttggtttta |
25121448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 494405 - 494453
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
494453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 543725 - 543673
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
543725 |
aggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatc |
543673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 8681120 - 8681068
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
8681120 |
aaaaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
8681068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 15962389 - 15962341
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
15962341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 22792903 - 22792851
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
22792903 |
aaaaggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
22792851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 23628794 - 23628846
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
23628794 |
aaaaagctaaaatatggttttggtccctgcaaatatatttcgttttggtttta |
23628846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 24901239 - 24901287
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24901287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 31166866 - 31166918
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31166866 |
aaaaagctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
31166918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 34582529 - 34582577
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
34582577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 21995061 - 21995112
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
21995061 |
aaaggctaaaatatggttttagtccctgcatatatgcctcgttttggtttta |
21995112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 22822654 - 22822603
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
22822654 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
22822603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 395
Target Start/End: Original strand, 23502233 - 23502284
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
23502233 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 396
Target Start/End: Complemental strand, 3969015 - 3968961
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3969015 |
ttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3968961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 6591440 - 6591394
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggtttta |
6591394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 8680769 - 8680823
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
8680769 |
ttaataggctaaaatatgtttttagtccctgcaaatatgcctcgttttggtttta |
8680823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 12299142 - 12299092
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
12299142 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
12299092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 14428948 - 14428902
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggtttta |
14428902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 14656262 - 14656212
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
14656262 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
14656212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 404
Target Start/End: Original strand, 19320769 - 19320823
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgt |
19320823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 396
Target Start/End: Complemental strand, 30929050 - 30928996
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30929050 |
ttaaatggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
30928996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 31398543 - 31398493
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
31398543 |
aaggctaaaatatgattttagtccctgcaaatatgtctcattttggtttta |
31398493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 1007510 - 1007461
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
1007510 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1007461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 1890453 - 1890404
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
1890453 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
1890404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 2615871 - 2615920
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2615871 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
2615920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 395
Target Start/End: Complemental strand, 2616242 - 2616193
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
2616242 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 3356495 - 3356450
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3356450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 3414386 - 3414435
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3414386 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3414435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 6564944 - 6564888
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
6564944 |
aggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
6564888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 395
Target Start/End: Original strand, 6591113 - 6591162
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
6591113 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 12419707 - 12419756
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
12419707 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
12419756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 12419939 - 12419890
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
12419939 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
12419890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 15962026 - 15962075
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
15962026 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
15962075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 18024376 - 18024327
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
18024376 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
18024327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 19321132 - 19321083
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
19321132 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19321083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 20467719 - 20467670
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
20467719 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20467670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 21147403 - 21147452
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
21147403 |
aggctaaaatatggttttggtccctgcaaatatgcatcgttttggtttta |
21147452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 21993786 - 21993835
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
21993786 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggtttta |
21993835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 21994404 - 21994355
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
21994404 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
21994355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 22543353 - 22543402
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
22543353 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
22543402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 25137358 - 25137309
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
25137358 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25137309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 26376042 - 26375997
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
26375997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 339 - 396
Target Start/End: Original strand, 31198606 - 31198663
Alignment:
| Q |
339 |
atgttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31198606 |
atgttaatgggctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
31198663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 32885672 - 32885721
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
32885672 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
32885721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 34582893 - 34582844
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34582893 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
34582844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 352 - 396
Target Start/End: Original strand, 543365 - 543409
Alignment:
| Q |
352 |
aaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 393
Target Start/End: Original strand, 2373176 - 2373224
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtt |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
2373176 |
aaaggctaaaatatggttttagtccctgcaaatatgccttgttttggtt |
2373224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 13150754 - 13150702
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
13150754 |
aaaaggctaaaatatggtattaacccctgcaaatatgtctcgttttggtttta |
13150702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 14655903 - 14655951
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggtttta |
14655951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 19267565 - 19267613
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggtttta |
19267613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 21385588 - 21385536
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
21385588 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
21385536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 30239293 - 30239341
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggtttta |
30239341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 31167200 - 31167152
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgatttta |
31167152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 33131854 - 33131802
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
33131854 |
aaaaggctaaaatatggttttagtctttgcaaatatgcctcgttttggtttta |
33131802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 346 - 393
Target Start/End: Complemental strand, 11449171 - 11449124
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtt |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
11449171 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtt |
11449124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 14428651 - 14428698
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
14428698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 19296105 - 19296156
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
19296105 |
aaaggctaaaacatggttttagtccctgcaaatatgcgtcgttttgatttta |
19296156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 22822304 - 22822355
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
22822304 |
aaaggctaaaatatggttttagtctctgcaaatatacctcgttttggtttta |
22822355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 25136991 - 25137042
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
25136991 |
aaaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggtttta |
25137042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 5286949 - 5286903
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
5286903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 6412581 - 6412531
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
6412581 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
6412531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 13268107 - 13268157
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||| ||||||| |
|
|
| T |
13268107 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgtttaggtttta |
13268157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 13617531 - 13617577
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
13617577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 380
Target Start/End: Complemental strand, 15117042 - 15117008
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15117042 |
aaggctaaaatatggttttagtccctgcaaatatg |
15117008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 347 - 389
Target Start/End: Complemental strand, 23770440 - 23770398
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgtttt |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23770440 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 25431574 - 25431624
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
25431574 |
aaggctaaaatatgattttaatccctgtaaatatgtttcgttttgatttta |
25431624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 33808614 - 33808668
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
33808614 |
ttaagaggctaaaatatggttttagtccctgtaaatatgcctcgttttgatttta |
33808668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 778043 - 777994
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
778043 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttagtttta |
777994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 1214997 - 1214948
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
1214997 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggtttta |
1214948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 12298825 - 12298870
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgtttta |
12298870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 12612360 - 12612311
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
12612360 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgttttagtttta |
12612311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 19129521 - 19129472
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| ||||||||||||| |
|
|
| T |
19129521 |
aggctaaaatatgattttggtccctgcaaatatgtcacgttttggtttta |
19129472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 10910629 - 10910677
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||| || ||||||||| |||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggtttta |
10910677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 404
Target Start/End: Original strand, 11925739 - 11925795
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||| ||||| |||| |||||||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
11925739 |
ggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtctctgt |
11925795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 345 - 389
Target Start/End: Complemental strand, 17765378 - 17765334
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgtttt |
389 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
17765378 |
aaaggctaaaatatgattttggtccctgcaaatatgtctcgtttt |
17765334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 352 - 396
Target Start/End: Original strand, 19275044 - 19275088
Alignment:
| Q |
352 |
aaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||||||||||||||| |
|
|
| T |
19275044 |
aaaatatggttttaggctctgcagatatgtttcgttttggtttta |
19275088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 21995425 - 21995377
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||| |||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggcttta |
21995377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 349 - 393
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtt |
393 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || |||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 777674 - 777725
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
777674 |
aaaggctaaaatatgattttagttcctgcaaatatacctcgttttggtttta |
777725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 1890056 - 1890107
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
1890056 |
aaaggttaaaatatggttttagtccctgtaaatatgcctcgttttgatttta |
1890107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 395
Target Start/End: Complemental strand, 11129543 - 11129496
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
11129543 |
ggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 399
Target Start/End: Complemental strand, 12757936 - 12757885
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
|||||||| ||| |||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
12757936 |
ggctaaaacatgattttggtccctgcaaatatgtatccttttggttttaatc |
12757885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 20467348 - 20467399
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| |||||||| ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
20467348 |
aaaggataaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
20467399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 347 - 402
Target Start/End: Original strand, 25121183 - 25121237
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctct |
402 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
25121183 |
aggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagtctct |
25121237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 354 - 393
Target Start/End: Complemental strand, 32885960 - 32885921
Alignment:
| Q |
354 |
aatatggttttagtccctgcaaatatgtttcgttttggtt |
393 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
32885960 |
aatatggttttagtccctgcaaatatgtctcattttggtt |
32885921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 34989962 - 34990009
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgatttta |
34990009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 1214694 - 1214744
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||| | ||||||||||| |
|
|
| T |
1214694 |
aaggctaaaatattgttttggtccctgcaaatatgtcgcattttggtttta |
1214744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 6564580 - 6564630
Alignment:
| Q |
347 |
aggctaaaatatggttttag-tccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
6564580 |
aggctaaattatggtttttggtccctgcaaatatgtctcgttttggtttta |
6564630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 9896280 - 9896326
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || |||| |||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagtttta |
9896326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 15116672 - 15116719
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | |||||||||||||| |
|
|
| T |
15116672 |
aggctaaaatatggttttagtcgctgcaaata--tctcgttttggtttta |
15116719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 403
Target Start/End: Complemental strand, 19275223 - 19275181
Alignment:
| Q |
361 |
ttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtctctg |
19275181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 352 - 390
Target Start/End: Complemental strand, 19690755 - 19690717
Alignment:
| Q |
352 |
aaaatatggttttagtccctgcaaatatgtttcgttttg |
390 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgttttg |
19690717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 347 - 393
Target Start/End: Original strand, 30479062 - 30479108
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtt |
393 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
30479062 |
aggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 372
Target Start/End: Original strand, 33131549 - 33131579
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctg |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33131549 |
ttaaaaggctaaaatatggttttagtccctg |
33131579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 8169786 - 8169835
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||||| |||||| ||||| |
|
|
| T |
8169786 |
aggctaaaatatgattttggtccatgcaaatatgttttgttttgatttta |
8169835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 11926034 - 11925985
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||| ||||||||||||| |
|
|
| T |
11926034 |
aggctaaaatatggttttggtctctgaaaatatgtcgcgttttggtttta |
11925985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 15722609 - 15722658
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||| ||||| |
|
|
| T |
15722609 |
aggctaaaatatggttttggtctatgcaaatatgtctcgttttgatttta |
15722658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 19129335 - 19129384
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
19129335 |
aggctacaatatggctttggtccctgcaaatatgcctcgttttggtttta |
19129384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 12176385 - 12176433
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| || || |||||||| ||||||| |||||| |
|
|
| T |
12176385 |
ggctaaaatatggttttagcccatgtaaatatgtctcgttttagtttta |
12176433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 380
Target Start/End: Original strand, 12611995 - 12612027
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
12611995 |
ggctaaaatatggtgttagtccctgcaaatatg |
12612027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 15442937 - 15442985
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||| ||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgatttta |
15442985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 30479426 - 30479374
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||| || | |||||||||| |||||||||||||| |
|
|
| T |
30479426 |
aaaaagctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
30479374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 31186591 - 31186543
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||| |||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgtttta |
31186543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 8e-19; HSPs: 196)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 32626525 - 32626577
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32626525 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
32626577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 45290454 - 45290505
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45290454 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
45290505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 6567498 - 6567448
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6567498 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
6567448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 10887232 - 10887281
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10887232 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
10887281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 13260322 - 13260273
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13260322 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13260273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 14007488 - 14007537
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
14007537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 19622654 - 19622703
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19622654 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19622703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 21391095 - 21391144
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21391095 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
21391144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 30322924 - 30322977
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
30322924 |
taaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
30322977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 41358664 - 41358615
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41358664 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
41358615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 48609595 - 48609546
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48609595 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
48609546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 3247194 - 3247246
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
3247194 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3247246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 404
Target Start/End: Complemental strand, 12322970 - 12322914
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgt |
12322914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 19720708 - 19720760
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
19720708 |
aaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19720760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 22953556 - 22953508
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22953508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 26191359 - 26191407
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
26191407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 26191734 - 26191686
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26191686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 26442563 - 26442611
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26442611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 33379884 - 33379936
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33379884 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33379936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 34002944 - 34002892
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
34002944 |
aaaaggctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
34002892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 45368486 - 45368538
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45368486 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
45368538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 48609232 - 48609284
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
48609232 |
aaaaggctaaaatatggttttagtcccggcaaatatgtctcgttttggtttta |
48609284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 1810924 - 1810975
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1810924 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1810975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 11822001 - 11822052
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11822001 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
11822052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 404
Target Start/End: Original strand, 15211508 - 15211567
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
15211508 |
aaaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgt |
15211567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 24654170 - 24654119
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
24654170 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24654119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 33000672 - 33000621
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
33000672 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
33000621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 347 - 398
Target Start/End: Complemental strand, 45638895 - 45638844
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaat |
398 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
45638895 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaat |
45638844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 12360970 - 12360920
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
12360970 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12360920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 15526364 - 15526314
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
15526364 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
15526314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 17130086 - 17130032
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
17130086 |
aaagactaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatc |
17130032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 404
Target Start/End: Original strand, 17984331 - 17984389
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
17984331 |
aaggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtctctgt |
17984389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 18473597 - 18473547
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18473597 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18473547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 18899837 - 18899887
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18899837 |
aaggttaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
18899887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 26061954 - 26062004
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26061954 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
26062004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 29072495 - 29072545
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29072495 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29072545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 32729051 - 32729001
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32729051 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32729001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 35307713 - 35307763
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35307713 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35307763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 342 - 396
Target Start/End: Complemental strand, 38164301 - 38164247
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
38164301 |
ttaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38164247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 41881091 - 41881141
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
41881091 |
aaggctaaaatatggttttagtccctccaaatatgtctcgttttggtttta |
41881141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 49073688 - 49073742
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
49073688 |
aaaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatc |
49073742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 990380 - 990331
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
990380 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
990331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 8140433 - 8140482
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
8140433 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8140482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 10887599 - 10887550
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
10887599 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10887550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 11822366 - 11822317
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
11822366 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgctttta |
11822317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 13770488 - 13770537
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13770488 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
13770537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 18302388 - 18302339
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18302339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 18473271 - 18473320
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18473271 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18473320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 22919683 - 22919732
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22919683 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22919732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 343 - 396
Target Start/End: Complemental strand, 33045695 - 33045642
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
33045695 |
taaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
33045642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35005745 - 35005696
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35005745 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35005696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 39747836 - 39747787
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
39747836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
39747787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 41358368 - 41358417
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
41358417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 42482978 - 42483035
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
42482978 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgt |
42483035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 45380271 - 45380320
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
45380271 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45380320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 343 - 404
Target Start/End: Original strand, 46868221 - 46868282
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
46868221 |
taaaaggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtctctgt |
46868282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 50428872 - 50428929
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||| |||||||| |||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgt |
50428929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 3679622 - 3679674
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
3679622 |
aaaaggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
3679674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 7001897 - 7001849
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7001849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 10631164 - 10631212
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10631212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 10631532 - 10631480
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
10631532 |
aaaaggctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
10631480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 24507847 - 24507795
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24507847 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24507795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 24649350 - 24649398
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24649398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 24977778 - 24977826
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24977826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 404
Target Start/End: Original strand, 25658014 - 25658070
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgt |
25658070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 27521572 - 27521624
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
27521572 |
aaaaagctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
27521624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 347 - 395
Target Start/End: Original strand, 33067347 - 33067395
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
33067347 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt |
33067395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 35005440 - 35005492
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
35005440 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
35005492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 35056530 - 35056578
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35056578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 35308111 - 35308063
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35308063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 38150844 - 38150896
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
38150844 |
aaaaggttaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
38150896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 40718110 - 40718158
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
40718158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 45638580 - 45638628
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
45638628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 46868577 - 46868529
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
46868529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 3753214 - 3753261
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3753261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 3753575 - 3753524
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
3753575 |
aaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
3753524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 404
Target Start/End: Original strand, 4323829 - 4323884
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgt |
4323884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 404
Target Start/End: Complemental strand, 37625026 - 37624971
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||| || ||||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtctctgt |
37624971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 39303675 - 39303722
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggtttta |
39303722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 44641079 - 44641126
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44641126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 47819599 - 47819548
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
47819599 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
47819548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 52254180 - 52254231
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
52254180 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
52254231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 990086 - 990136
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
990086 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
990136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 4360628 - 4360578
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
4360628 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttggggtttta |
4360578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 4789310 - 4789356
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4789356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 7350421 - 7350471
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
7350421 |
aaggttaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
7350471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 8364614 - 8364664
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8364614 |
aaggttaaaatatggttttgatccctgcaaatatgtttcgttttggtttta |
8364664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 12361009 - 12361059
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
12361009 |
aaggctaaaatatggttttagtccctgcaaatttgcctcgttttggtttta |
12361059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 16083045 - 16083095
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
16083045 |
aaggctaaaatatggttttagtccccgcaaatatgtctcgtttttgtttta |
16083095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 19623019 - 19622969
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
19623019 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
19622969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 26442901 - 26442851
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
26442901 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
26442851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 29688430 - 29688380
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
29688430 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
29688380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 31258337 - 31258387
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
31258337 |
aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
31258387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 46183686 - 46183732
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
46183732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 404
Target Start/End: Original strand, 4617091 - 4617144
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |||||| ||||||| |
|
|
| T |
4617091 |
taaaatatggttttggtccctgaaaatatgtttcgttttagttttagtctctgt |
4617144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 7819104 - 7819047
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
7819104 |
aggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgt |
7819047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 7867128 - 7867177
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
7867128 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
7867177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 13259987 - 13260036
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
13259987 |
aggctaaaatatggttttagtcgctgcaaatatggctcgttttggtttta |
13260036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 345 - 390
Target Start/End: Complemental strand, 18079663 - 18079618
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttg |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18079663 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 18900130 - 18900085
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggtttta |
18900085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 21383103 - 21383152
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
21383103 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggtttta |
21383152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 26324948 - 26324891
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
26324948 |
aggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctgt |
26324891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 32454295 - 32454246
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
32454295 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggcttta |
32454246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 349 - 398
Target Start/End: Complemental strand, 33067729 - 33067680
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaat |
398 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaat |
33067680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Original strand, 34808200 - 34808245
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggtttta |
34808245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 395
Target Start/End: Original strand, 37624744 - 37624793
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
37624744 |
aaggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt |
37624793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 395
Target Start/End: Complemental strand, 42483273 - 42483224
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
42483273 |
aaggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 45290821 - 45290772
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
45290821 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttta |
45290772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 47819231 - 47819280
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
47819231 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
47819280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 48955713 - 48955762
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
48955713 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
48955762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 50429210 - 50429161
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
50429210 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
50429161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 50799129 - 50799178
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
50799129 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
50799178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 12158690 - 12158738
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggtttta |
12158738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 12322604 - 12322652
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgatttta |
12322652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 15058770 - 15058718
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
15058770 |
aaaaggctaaaatattgttttgatccctgcaaatatgtctcgttttggtttta |
15058718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 17984701 - 17984653
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
17984653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 24510308 - 24510260
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgttttagtttta |
24510260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 24653802 - 24653850
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24653850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 26062262 - 26062210
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
26062262 |
aaaaggttaaaatatggttttagtccctgtaaatatgtctcattttggtttta |
26062210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 26207274 - 26207326
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
26207274 |
aaaagactaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
26207326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 29072862 - 29072814
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggtttta |
29072814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 31060787 - 31060835
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
31060835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 33234542 - 33234594
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
33234542 |
aaaaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
33234594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 37545628 - 37545676
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
37545676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 38151212 - 38151164
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38151164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 44158046 - 44157994
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
44158046 |
aaaaggctaaaatatggtttttgtccctgcaaatatgcctagttttggtttta |
44157994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 44641432 - 44641384
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
44641384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 48956066 - 48956018
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
48956018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 52254479 - 52254431
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
52254431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 7818783 - 7818830
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
7818830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 15058419 - 15058466
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
15058466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 345 - 404
Target Start/End: Complemental strand, 21391377 - 21391318
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| ||||||| |||||| ||||||| |
|
|
| T |
21391377 |
aaaggttaaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctgt |
21391318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 32420099 - 32420146
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
32420146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 344 - 395
Target Start/End: Original strand, 34002631 - 34002682
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||| ||||||||||||| |
|
|
| T |
34002631 |
aaaaggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 347 - 390
Target Start/End: Original strand, 36912852 - 36912895
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttg |
390 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
36912852 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 41739121 - 41739075
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41739121 |
aggctaaaatatggttttagtccctgcaaata---ttcgttttggtttta |
41739075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 349 - 396
Target Start/End: Original strand, 44157696 - 44157743
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
44157743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 4324169 - 4324115
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||| ||||||||| ||||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
4324169 |
aaaggttaaaatatgattttagttcatgcaaatatgtctcgttttggttttaatc |
4324115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 7867359 - 7867309
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| | ||||||||||| |
|
|
| T |
7867359 |
aaggctaaaatatggttttggtccctgcaaatatgtcttattttggtttta |
7867309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 8140801 - 8140751
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
8140801 |
aaggctaaaatatggttttggtacctgcaaatatgcctcgttttggtttta |
8140751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 31061153 - 31061103
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
31061153 |
aaggctaaaatatggttttgatccctgcaaatatatctcgttttggtttta |
31061103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 38163929 - 38163979
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
38163929 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38163979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 3247559 - 3247514
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3247514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 4617396 - 4617339
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||| |||| || || |||||||||||||||||||||||| ||||||| |
|
|
| T |
4617396 |
aggctaaaatatgattttggttccaacaaatatgtttcgttttggttttagtctctgt |
4617339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 15335292 - 15335247
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
15335247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 15516581 - 15516630
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
15516581 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggtttta |
15516630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 16026939 - 16026890
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
16026939 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16026890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 22674202 - 22674251
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
22674202 |
aggctaaaatatggtttaggtccatgcaaatatgtctcgttttggtttta |
22674251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 22919978 - 22919929
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
22919978 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttagtttta |
22919929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 24649661 - 24649612
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
24649661 |
aggccaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
24649612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 26324584 - 26324633
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26324584 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
26324633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 369 - 402
Target Start/End: Original strand, 26699312 - 26699345
Alignment:
| Q |
369 |
cctgcaaatatgtttcgttttggttttaatctct |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26699312 |
cctgcaaatatgtttcgttttggttttaatctct |
26699345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 404
Target Start/End: Complemental strand, 26699607 - 26699551
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||| |||||| ||||||| |
|
|
| T |
26699607 |
aggctaaaatatggttttggtcc-tgcaaatatgcttcgtttttgttttagtctctgt |
26699551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 30323294 - 30323245
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30323294 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
30323245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 31258699 - 31258654
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgtttta |
31258654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 343 - 404
Target Start/End: Original strand, 34382942 - 34383002
Alignment:
| Q |
343 |
taaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
34382942 |
taaaatgctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagtctctgt |
34383002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35056895 - 35056846
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
35056895 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
35056846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 346 - 395
Target Start/End: Original strand, 39025107 - 39025156
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
39025107 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
39025156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 3679986 - 3679938
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgatttta |
3679938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 395
Target Start/End: Complemental strand, 8364917 - 8364869
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
8364917 |
aggctaaaatatagttttggtccccgcaaatatgtctcgttttggtttt |
8364869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 16060885 - 16060837
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16060837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 20948755 - 20948803
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |||||| ||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggtttta |
20948803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 24507479 - 24507527
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
24507527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 33000305 - 33000353
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgatttta |
33000353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 38136981 - 38136933
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
38136933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 45380636 - 45380588
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
45380588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 292855 - 292907
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
292855 |
ttaaaaggctaaaat--ggttttagtccctgcaaatatgcctcgttttgctttta |
292907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 353 - 396
Target Start/End: Original strand, 2939934 - 2939977
Alignment:
| Q |
353 |
aaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggtttta |
2939977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 389
Target Start/End: Complemental strand, 4565342 - 4565295
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgtttt |
389 |
Q |
| |
|
|||| |||||||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
4565342 |
ttaataggctaaaatatggttctggtccctgcaaatatgtctcgtttt |
4565295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 348 - 399
Target Start/End: Complemental strand, 15211858 - 15211807
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||| |||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatc |
15211807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 347 - 398
Target Start/End: Original strand, 15334916 - 15334967
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaat |
398 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||| |||||||||||||||| |
|
|
| T |
15334916 |
aggctaaaatatggttttaatctctgtaaatatgactcgttttggttttaat |
15334967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 16060593 - 16060643
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
16060593 |
aaaggctaaaatatggttttggtccct-caaatatgcctcgttttggtttta |
16060643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 353 - 404
Target Start/End: Complemental strand, 16083394 - 16083343
Alignment:
| Q |
353 |
aaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagtctctgt |
16083343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 4360290 - 4360343
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| || ||||||||||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
4360290 |
ttaaatggttaaaatatggttttagt-cctgcaaatatgtcttgttttggtttta |
4360343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 380
Target Start/End: Original strand, 12360597 - 12360635
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
12360597 |
ttaataggctaaaatatggttttggtccctgcaaatatg |
12360635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 395
Target Start/End: Original strand, 18927850 - 18927884
Alignment:
| Q |
361 |
ttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
18927850 |
ttttggtccctgcaaatatgtttcgttttggtttt |
18927884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 347 - 381
Target Start/End: Complemental strand, 32035789 - 32035755
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgt |
381 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
32035789 |
aggctaaaatatggttttggtccctgcaaatatgt |
32035755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 39747472 - 39747521
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| || |||||||||| || |||||||||||||| |
|
|
| T |
39747472 |
aaggctaaaatatggttttggt-cctgcaaatacgtctcgttttggtttta |
39747521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 376
Target Start/End: Complemental strand, 41881348 - 41881318
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaa |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41881348 |
aaggctaaaatatggttttagtccctgcaaa |
41881318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 396
Target Start/End: Complemental strand, 45368847 - 45368801
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggtttta |
45368801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 379
Target Start/End: Original strand, 47038863 - 47038897
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47038863 |
aaaggctaaaatatgtttttagtccctgcaaatat |
47038897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 380
Target Start/End: Complemental strand, 1811236 - 1811203
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
1811236 |
aggctaaaatatgattttagtccctgcaaatatg |
1811203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 380
Target Start/End: Complemental strand, 2604187 - 2604154
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
2604187 |
aggctaaaatatgtttttagtccctgcaaatatg |
2604154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 19721071 - 19721026
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
19721026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 28507459 - 28507410
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||| || |||| |||||| |
|
|
| T |
28507459 |
aggctaaaatattgttttggtccctgcaaatatgtctcattttagtttta |
28507410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 33045354 - 33045403
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
33045354 |
aggctaaaatttggttttggtccctgcaaatatgcctagttttggtttta |
33045403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 49923819 - 49923770
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| ||||||||| ||||| |
|
|
| T |
49923819 |
aggctaaaatatgattttggtctctgcaaatatgcttcgttttgatttta |
49923770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 372
Target Start/End: Original strand, 7001608 - 7001636
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctg |
372 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7001608 |
aaaaggctaaaatatggttttagtccctg |
7001636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 18079394 - 18079446
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||||| || ||||||||||| |
|
|
| T |
18079394 |
aaaaggctaaaatacggttttggtccttgcaaatatgcctcattttggtttta |
18079446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 22953252 - 22953304
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||| ||||||||| |||||||||| ||||||||||| || |||||| |||| |
|
|
| T |
22953252 |
aaaagactaaaatatagttttagtccatgcaaatatgtctcattttggattta |
22953304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 33234912 - 33234864
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
33234864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 34383244 - 34383196
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| ||||||| |||| |||||||| | |||||||||||| |
|
|
| T |
34383244 |
ggctaaaatatgattttagttcctgtaaatatgtattgttttggtttta |
34383196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 39025381 - 39025334
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggtttta |
39025334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 380
Target Start/End: Complemental strand, 40718474 - 40718442
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatg |
40718442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 348 - 380
Target Start/End: Original strand, 41738796 - 41738828
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatg |
380 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatg |
41738828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 395
Target Start/End: Complemental strand, 49074054 - 49074006
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttt |
395 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||| ||||||||| |||| |
|
|
| T |
49074054 |
aggctaaaatatggttttggtccttgtaaatatgcttcgttttgatttt |
49074006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 291 - 241
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
291 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 342 - 396
Target Start/End: Complemental strand, 8648 - 8594
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
8648 |
ttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
8594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 8326 - 8378
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
8326 |
aaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatttta |
8378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 46; Significance: 5e-17; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 4040 - 4089
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4040 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 19222 - 19271
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19222 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 4291 - 4240
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
4291 |
aaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
4240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 19473 - 19422
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
19473 |
aaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
19422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 5205 - 5257
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5205 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 5225 - 5277
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5225 |
aaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 12525 - 12573
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
12573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 3532 - 3580
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
3580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Complemental strand, 3921 - 3870
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3921 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
3870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 44; Significance: 8e-16; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 47922 - 47973
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
47922 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
47973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 351 - 404
Target Start/End: Complemental strand, 48228 - 48175
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgt |
48175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 223173 - 223124
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || |||||||||| |
|
|
| T |
223173 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggtttta |
223124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 2776 - 2826
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2776 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 345 - 403
Target Start/End: Original strand, 5396 - 5454
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
5396 |
aaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctg |
5454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 5710 - 5660
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
5710 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
5660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 366275 - 366225
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
366275 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
366225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 365979 - 366027
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggtttta |
366027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 14696 - 14745
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14696 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 15013 - 14964
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
14964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 3292 - 3243
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3292 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
3243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 24371 - 24420
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
24371 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggtttta |
24420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 27365 - 27316
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
27365 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
27316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 26999 - 27050
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||| |||| ||||||| |||||||||||||||| ||||||| ||||||||| |
|
|
| T |
26999 |
aggctcaaatttggttttggtccctgcaaatatgtctcgtttt-gttttaatc |
27050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 3751 - 3808
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
3751 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgt |
3808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 347 - 402
Target Start/End: Complemental strand, 4080 - 4025
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctct |
402 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||| ||||||| |||||| ||||| |
|
|
| T |
4080 |
aggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtctct |
4025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 10516 - 10467
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
10516 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggtttta |
10467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 10168 - 10216
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
10216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 404
Target Start/End: Original strand, 94056 - 94113
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
94056 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgt |
94113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 349 - 398
Target Start/End: Complemental strand, 94329 - 94280
Alignment:
| Q |
349 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaat |
398 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttttaat |
94280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 9028 - 8980
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 8734 - 8780
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 148282 - 148234
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
148234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 396
Target Start/End: Original strand, 54812 - 54863
Alignment:
| Q |
345 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
54812 |
aaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
54863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 50075 - 50030
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
50030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 351 - 396
Target Start/End: Complemental strand, 55176 - 55131
Alignment:
| Q |
351 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
55131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 8545 - 8595
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
8545 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
8595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 348 - 394
Target Start/End: Complemental strand, 4312 - 4266
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 355 - 396
Target Start/End: Original strand, 4016 - 4057
Alignment:
| Q |
355 |
atatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggtttta |
4057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 396
Target Start/End: Original strand, 82339 - 82389
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
82339 |
aaggctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
82389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 82707 - 82658
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
82707 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
82658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 75358 - 75407
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
75358 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggtttta |
75407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 75765 - 75716
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
75765 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
75716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 3455 - 3407
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggtttta |
3407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 400
Target Start/End: Original strand, 21692 - 21747
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatct |
400 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
21692 |
aaaaggctaaaatatggttttgatccctgcaaatatg-ttcgttttggtattaatct |
21747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 22057 - 22007
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| || |||||||||||||| |
|
|
| T |
22057 |
aaggctaaaatatggttttggtcccttcaaatttgcctcgttttggtttta |
22007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 34931 - 34979
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggtttta |
34979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 12182 - 12230
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
12230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 348 - 396
Target Start/End: Complemental strand, 12536 - 12488
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
12488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 404
Target Start/End: Complemental strand, 189682 - 189622
Alignment:
| Q |
344 |
aaaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
||||||||||||||| ||||| ||| ||||||||||| || ||||||||||||||||||| |
|
|
| T |
189682 |
aaaaggctaaaatatagtttttgtcgctgcaaatatgcctcattttggttttaatctctgt |
189622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 348 - 399
Target Start/End: Complemental strand, 44206 - 44155
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatc |
399 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggttttaatc |
44155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 404
Target Start/End: Complemental strand, 7266 - 7208
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttaatctctgt |
404 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||| | |||||||||||||| ||||| |
|
|
| T |
7266 |
aaggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttaatttctgt |
7208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 396
Target Start/End: Original strand, 17126 - 17172
Alignment:
| Q |
350 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggtttta |
17172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 394
Target Start/End: Complemental strand, 17966 - 17920
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggttt |
17920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 390
Target Start/End: Complemental strand, 2883 - 2841
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttg |
390 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
2841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Original strand, 2500 - 2549
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
2500 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttgatttta |
2549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 2661 - 2612
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
2661 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggtttta |
2612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 18044 - 17995
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||| |||| |
|
|
| T |
18044 |
aggctaaaatatggttttagtccctgcgaatatgcctcgttttggattta |
17995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 348 - 396
Target Start/End: Original strand, 16724 - 16772
Alignment:
| Q |
348 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | |||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggtttta |
16772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 396
Target Start/End: Complemental strand, 5072 - 5022
Alignment:
| Q |
346 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||| | |||||||||||||| |
|
|
| T |
5072 |
aaggttaaaatatggttttggtctctgcaaatatatctcgttttggtttta |
5022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 379
Target Start/End: Complemental strand, 30972 - 30935
Alignment:
| Q |
342 |
ttaaaaggctaaaatatggttttagtccctgcaaatat |
379 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
30972 |
ttaataggctaaaatatggttttggtccctgcaaatat |
30935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 396
Target Start/End: Complemental strand, 35085 - 35036
Alignment:
| Q |
347 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
396 |
Q |
| |
|
|||||||||||||||||| ||| | ||||||||| |||||||||||||| |
|
|
| T |
35085 |
aggctaaaatatggttttgatccgtacaaatatgtctcgttttggtttta |
35036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University