View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3615_low_20 (Length: 257)
Name: NF3615_low_20
Description: NF3615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3615_low_20 |
 |  |
|
| [»] scaffold0722 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0722 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: scaffold0722
Description:
Target: scaffold0722; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 3463 - 3683
Alignment:
| Q |
18 |
gaatcctgagacagattggaaagcctttgatataaggttcttgttttcattgttgcatgaagatgatgattgtgtgagagtaataagtgttagaagaatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3463 |
gaatcctgagacagattggaaagcctttgatataaggttcttgttttcattgttgcatgaagatgatgattgtgtgagactaataagtgttagaagaatc |
3562 |
T |
 |
| Q |
118 |
aaaaacctacaaaaatgtttcannnnnnnncttcctcttctacttggttgcacaatctcaatcttaatctcatgtggtattatacttgaaagaaagaaaa |
217 |
Q |
| |
|
|| |||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3563 |
aagaacctaaaaaggtgtttcattttttttcttcctcttctacttggttgcacaatctcaatcttaatctcatgtggtattatacttgaaagaaagaaaa |
3662 |
T |
 |
| Q |
218 |
gacagtgaaaagagacagagt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3663 |
gacagtgaaaagagacagagt |
3683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University