View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3615_low_27 (Length: 238)
Name: NF3615_low_27
Description: NF3615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3615_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 28471849 - 28472069
Alignment:
| Q |
1 |
ccaattccattaggtttcagaatacgttcaacttcaaggacaaccaatgcagggacagcaacttttcccaaatccttggacaaaacaaagtcgaacgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28471849 |
ccaattccattaggtttcagaatacgttcaacttcaaggacaaccaatgcagggacagcaacttttcccaaatccttggacaaaacaaagtcgaacgatt |
28471948 |
T |
 |
| Q |
101 |
catcgtggtgatgatcaagcgagtaaacaaaattcttcttgttgaatgagaaaacacgatggttaatcacattagagaaaccaagtttcttcagtgtgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28471949 |
catcgtggtgatgatcaagcgagtaaacaaaattcttcttgttgaatgagaaaacacgatggttaatcacattagtgaaaccaagtttcttcagtgtgga |
28472048 |
T |
 |
| Q |
201 |
aacagctatgtttgaagtttc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28472049 |
aacagctatgtttgaagtttc |
28472069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 40806297 - 40806240
Alignment:
| Q |
1 |
ccaattccattaggtttcagaatacgttcaacttcaaggacaaccaatgcagggacag |
58 |
Q |
| |
|
|||||||||||||| || |||| ||||||||| ||||| |||| ||| |||||||||| |
|
|
| T |
40806297 |
ccaattccattaggcttaagaacacgttcaacctcaagaacaagcaaagcagggacag |
40806240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University