View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3616_high_8 (Length: 211)
Name: NF3616_high_8
Description: NF3616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3616_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 22 - 196
Target Start/End: Complemental strand, 53676822 - 53676648
Alignment:
| Q |
22 |
gaataatgatgtagaaaattgtggaagtagaagcatgcttgtggactcaagttgaggatttaggaacaatgacgtagaaattgtaattttatttagcttg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676822 |
gaataatgatgtagaaaattgtggaagtagaagcctgcttgtggactcaagttgaggatttaggaacaatgacgtagaaattgtaattttatttagcttg |
53676723 |
T |
 |
| Q |
122 |
tctgcatatttgtcatggaacttttcaatgctgaaaattttactatctgttatgtgtgcagttgatgtagataat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676722 |
tctgcatatttgtcatggaacttttcaatgctgaaaattttactatctgttatgtgtgcagttgatgtagataat |
53676648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 22 - 141
Target Start/End: Complemental strand, 34131193 - 34131071
Alignment:
| Q |
22 |
gaataatgatgtagaaaattgtggaagtagaagcatgcttgtggactcaagttgaggatttaggaacaa---tgacgtagaaattgtaattttatttagc |
118 |
Q |
| |
|
|||||||||| ||||||||||| || |||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||| | |
|
|
| T |
34131193 |
gaataatgatttagaaaattgtagaggtagaagcatgcttgtggactccagttgaggatttaggaacaatattgacatagaaattgtaattttatttaac |
34131094 |
T |
 |
| Q |
119 |
ttgtctgcatatttgtcatggaa |
141 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34131093 |
ttgtctgcatatttgtcatggaa |
34131071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University