View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3616_low_7 (Length: 237)

Name: NF3616_low_7
Description: NF3616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3616_low_7
NF3616_low_7
[»] chr6 (1 HSPs)
chr6 (52-210)||(10784874-10785031)


Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 52 - 210
Target Start/End: Original strand, 10784874 - 10785031
Alignment:
52 tttaatattcatcttcatttcatcttatcattccaatccagattcagttgatttgtaacagaggatgaattggttaaccccagtaatgaacccacccttc 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||||||    
10784874 tttaatattcatcttcatttcatcttatcattccaatccagattcagttgatt-gtaatagaggatgaattggttaacccctgtaatgaacccacccttc 10784972  T
152 tcggaacaaccgtaaattcttcaagcttgttcgaagtcgaaggttaacgctaaggtcat 210  Q
     |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
10784973 ccggaacaaccgtaaattcttcaagcttgttcgaagtcgaaggttaaagctaaggtcat 10785031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University