View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3616_low_7 (Length: 237)
Name: NF3616_low_7
Description: NF3616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3616_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 52 - 210
Target Start/End: Original strand, 10784874 - 10785031
Alignment:
| Q |
52 |
tttaatattcatcttcatttcatcttatcattccaatccagattcagttgatttgtaacagaggatgaattggttaaccccagtaatgaacccacccttc |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10784874 |
tttaatattcatcttcatttcatcttatcattccaatccagattcagttgatt-gtaatagaggatgaattggttaacccctgtaatgaacccacccttc |
10784972 |
T |
|
| Q |
152 |
tcggaacaaccgtaaattcttcaagcttgttcgaagtcgaaggttaacgctaaggtcat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10784973 |
ccggaacaaccgtaaattcttcaagcttgttcgaagtcgaaggttaaagctaaggtcat |
10785031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University