View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3617_high_1 (Length: 261)
Name: NF3617_high_1
Description: NF3617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3617_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 39986687 - 39986861
Alignment:
| Q |
1 |
ttattgtttggataaagataaactaagaaatcacttt-cattggcttttagagaagtataacaattttttccctttcaatttcatcacttatctcttgaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39986687 |
ttattgtttggataaagataaactaagaaatcacttttcattggcttttagagaagtataacaattttttccctttcaatttcatcacttatctcttgaa |
39986786 |
T |
 |
| Q |
100 |
ttgaaatgcacgcgtgcatacataatgtcataatcaaaacacctactgtaa----tcatttatctttctcttcac |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
39986787 |
ttgaaatgcacgcgtgcatacataatgtcataatcaaaacacctactgtaataattaatttatctttctcttcac |
39986861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University