View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3617_high_4 (Length: 245)
Name: NF3617_high_4
Description: NF3617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3617_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 11 - 122
Target Start/End: Complemental strand, 50834423 - 50834313
Alignment:
| Q |
11 |
agaagcatagggtctgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgtagtggctccgtgaatacttaaaattccaataaca |
110 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
50834423 |
agaagaatagggt-tgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgtagtggcttcgtgaataattaaaattccaataaca |
50834325 |
T |
 |
| Q |
111 |
atcagatttcat |
122 |
Q |
| |
|
|||||||||||| |
|
|
| T |
50834324 |
atcagatttcat |
50834313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 11 - 122
Target Start/End: Original strand, 50841430 - 50841540
Alignment:
| Q |
11 |
agaagcatagggtctgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgtagtggctccgtgaatacttaaaattccaataaca |
110 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
50841430 |
agaagaatagggt-tgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgtagtggcttcgtgaataattaaaattccaataaca |
50841528 |
T |
 |
| Q |
111 |
atcagatttcat |
122 |
Q |
| |
|
|||||||||||| |
|
|
| T |
50841529 |
atcagatttcat |
50841540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University