View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3618_high_5 (Length: 213)
Name: NF3618_high_5
Description: NF3618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3618_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 52 - 195
Target Start/End: Original strand, 38452874 - 38453017
Alignment:
| Q |
52 |
tggattacactcatcaatgatgagtggaaaaactgaatcccttcagattttcttgtggaattcatgcacctcttaatctgtttacattctctatccatac |
151 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
38452874 |
tggattacgctcatcaatgatgagtggaaaaactgaacccctttggattttcttgtggaattcatgtacctcttaatctgtttacaatctctatccatac |
38452973 |
T |
 |
| Q |
152 |
caaaacgtttcagtcaatgtttcaaatattatagttacaatatt |
195 |
Q |
| |
|
||||| |||| |||| ||||||||||||| || || ||||||| |
|
|
| T |
38452974 |
caaaatgtttacgtcagtgtttcaaatattctacttgcaatatt |
38453017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 64 - 135
Target Start/End: Complemental strand, 38637798 - 38637727
Alignment:
| Q |
64 |
atcaatgatgagtggaaaaactgaatcccttcagattttcttgtggaattcatgcacctcttaatctgttta |
135 |
Q |
| |
|
|||||||||||||||||||||| | || || |||||| | || ||||||||| ||||||||||||||||| |
|
|
| T |
38637798 |
atcaatgatgagtggaaaaactaagcccttttggattttatcgtagaattcatgtacctcttaatctgttta |
38637727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University