View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3618_low_2 (Length: 247)
Name: NF3618_low_2
Description: NF3618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3618_low_2 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 115 - 247
Target Start/End: Original strand, 28939866 - 28939999
Alignment:
| Q |
115 |
ttaaataagttttttctctctataaatatctcaaacttcctcctcaaaa-aatatcaaattttgattttcatccctttaaaaaattgtcaacaagttttc |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28939866 |
ttaaataagttttttctctctatcaatatctaaaacttcctcctcaaaaaaatatcaaattttgattttcatccctttaaaaaattgtcaacaagttttc |
28939965 |
T |
 |
| Q |
214 |
gtcccttaaatattttccgtcacgacttttcatc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28939966 |
gtcccttaaatattttccgtcacgacttttcatc |
28939999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 115 - 149
Target Start/End: Complemental strand, 27987414 - 27987380
Alignment:
| Q |
115 |
ttaaataagttttttctctctataaatatctcaaa |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27987414 |
ttaaataagttttttctctctataaatatctcaaa |
27987380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 115 - 149
Target Start/End: Complemental strand, 28073946 - 28073912
Alignment:
| Q |
115 |
ttaaataagttttttctctctataaatatctcaaa |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28073946 |
ttaaataagttttttctctctataaatatctcaaa |
28073912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University