View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3619_low_12 (Length: 231)
Name: NF3619_low_12
Description: NF3619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3619_low_12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 231
Target Start/End: Original strand, 38868144 - 38868355
Alignment:
| Q |
20 |
atcatatgcaaatttacccactctgatcataactcatgattatacacaataatttatgagcttgtttatagtggcatgtatatactttccggctcttaat |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38868144 |
atcatatgcatatttacccactctgatcataagtcatgattatacacaataatttatgagcttgtttatagtggcatgtatatacttgccggctcttaat |
38868243 |
T |
|
| Q |
120 |
catgtcaaatgattcagctgcaccacagaaacttacatggccccaaatctagtggctttgtattcttcacaatttcaaagttatctttcagtcttatata |
219 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | || ||| | ||||||||||||||||| || ||||| || ||||||||||||| ||||||||||| |
|
|
| T |
38868244 |
catgccaaatgattcagctgcaccacagaaattaacctggtctcaaatctagtggctttgaatccttcaatatgtcaaagttatcttctagtcttatata |
38868343 |
T |
|
| Q |
220 |
tactttcctctc |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
38868344 |
gactttcctctc |
38868355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University